ID: 1195623479

View in Genome Browser
Species Human (GRCh38)
Location X:106983137-106983159
Sequence CACTTCCGATTTTAGATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 1, 2: 25, 3: 234, 4: 740}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195623477_1195623479 23 Left 1195623477 X:106983091-106983113 CCTTTGAGTTGTCATGTCTGTGC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG 0: 1
1: 1
2: 25
3: 234
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195623479 Original CRISPR CACTTCCGATTTTAGATTTT TGG Intronic
900878359 1:5362515-5362537 CATTTCAGATTTTGGATTTTTGG + Intergenic
902080457 1:13817093-13817115 CATTTCAGATTTTGGATTTTTGG - Intronic
902812579 1:18897086-18897108 CATTTCGGATTTTGGATTTTTGG - Intronic
903084848 1:20846793-20846815 CACTTACTACTTTAGAGTTTAGG + Intronic
903225414 1:21892019-21892041 CACACCGGATTTCAGATTTTTGG - Intronic
904243189 1:29164899-29164921 CATTTCAGATTTTGGATTTTCGG - Intronic
904509814 1:30995017-30995039 CACTTCTGATTTTTGAATATGGG - Intronic
904729886 1:32582152-32582174 CATTTCAGATTTTGAATTTTTGG - Intronic
905720171 1:40192481-40192503 CATTTTGGATTTCAGATTTTTGG + Intronic
906106588 1:43297604-43297626 CATTTCAGATTTCACATTTTCGG - Intergenic
906415133 1:45615826-45615848 CATTTCAGATTTTAGATTAAGGG - Intronic
906452981 1:45967997-45968019 CATTTTGGATTTCAGATTTTTGG - Intronic
906610407 1:47197902-47197924 CATTTCGGATTTCAGATTTTTGG + Intergenic
906718933 1:47991885-47991907 CATTTCTGATTTTGAATTTTTGG + Intronic
906911236 1:49953645-49953667 CATTTCAGATTTCAGATTTTTGG + Intronic
907000915 1:50854834-50854856 CACTTTGGATTTTGGATTTTTGG - Intronic
907000933 1:50855032-50855054 CATTTTGGATTTTAGATTTTTGG + Intronic
907335922 1:53699526-53699548 CATTTCAGACTTTGGATTTTTGG - Intronic
907737845 1:57132574-57132596 CATTTCACATTTTGGATTTTTGG + Intronic
908024495 1:59936332-59936354 CACTCCTGATTTTATAGTTTAGG - Intergenic
908304897 1:62802401-62802423 CATTTTGGATTTTGGATTTTCGG + Intronic
908309207 1:62859190-62859212 GATTTCAGATTTTGGATTTTTGG + Intronic
908422959 1:63977424-63977446 CATTTTGGATTTTGGATTTTTGG + Intronic
909001143 1:70219089-70219111 CATTTCAGATTTTAAATGTTAGG + Intronic
909281166 1:73755676-73755698 CACTTCTGACATTAGATGTTGGG + Intergenic
909605895 1:77507978-77508000 CATTTTGGATTTTGGATTTTTGG - Intronic
909852921 1:80491793-80491815 CATTTCAGATTTCAGATGTTTGG - Intergenic
909903197 1:81163606-81163628 CACTTCTGATTTTATTTATTTGG - Intergenic
910071957 1:83227139-83227161 CACTTTGGATTTCAGATTTTTGG - Intergenic
910389701 1:86727438-86727460 CATTTCAGATTTCAGGTTTTTGG - Intronic
910581220 1:88827554-88827576 CATTTTAGATTTTGGATTTTTGG + Intronic
911633360 1:100207179-100207201 CATTTCAGATTTCAGATATTTGG - Intronic
911640417 1:100282648-100282670 TATTTCAGATTTTAGATTTTTGG - Intronic
911779605 1:101859610-101859632 CATTTTGGATTTTGGATTTTTGG - Intronic
912215868 1:107611134-107611156 CACATACGATTTTAGATTTTTGG - Intronic
912426488 1:109597038-109597060 CATTTTGGATTTCAGATTTTTGG - Exonic
912829051 1:112934245-112934267 CATTTCGAATTTTGGATTTTTGG + Intronic
913353534 1:117890916-117890938 CATTTCAGATTTTGTATTTTTGG - Intronic
914048471 1:144111320-144111342 CACTTCCCATCTTAGCTTCTGGG - Intergenic
914130713 1:144854128-144854150 CACTTCCCATCTTAGCTTCTGGG + Intergenic
915681999 1:157590300-157590322 CATTTCATATTTCAGATTTTTGG - Intronic
916161317 1:161917850-161917872 CAATTTGGATTTCAGATTTTTGG + Intronic
916251321 1:162741347-162741369 CATTTCGGATTTTGGATTTGTGG - Intronic
916251327 1:162741420-162741442 GATTTTGGATTTTAGATTTTTGG + Intronic
916507134 1:165438288-165438310 CATTTTGGATTTCAGATTTTTGG + Intronic
916507403 1:165440552-165440574 CATTTCAGATTTTAGATGCTTGG + Intronic
916879219 1:169002982-169003004 CATTTATGATTTTGGATTTTTGG - Intergenic
916919678 1:169451023-169451045 CATTTTGGATTTCAGATTTTTGG - Intronic
916994931 1:170286296-170286318 CATTTCGGGTTTTGGATTTTCGG - Intergenic
917213118 1:172650306-172650328 CATTTTGGATTTGAGATTTTGGG - Intergenic
917324707 1:173820143-173820165 CATTTTGGATTTCAGATTTTTGG - Intronic
917563852 1:176190313-176190335 CATTTCAAATTTCAGATTTTTGG + Intronic
917745872 1:178006470-178006492 CATTTCAGATTTTGGATTTTTGG - Intergenic
917887566 1:179401512-179401534 CATTTCTGAATTTAGATCTTAGG - Intronic
917908081 1:179609481-179609503 CATTTCAAATTTCAGATTTTTGG + Intronic
917993299 1:180406298-180406320 CACTTTGGATTTCAGACTTTTGG - Intronic
918121075 1:181540965-181540987 CATTTCAGATTTTGGAGTTTTGG + Intronic
918128143 1:181602408-181602430 CATTTCAGATTTCACATTTTTGG - Intronic
918128150 1:181602490-181602512 GATTTCAGATTTCAGATTTTTGG + Intronic
918363915 1:183786509-183786531 CATTTTAGATTTCAGATTTTAGG - Intronic
918603862 1:186397571-186397593 CATATAAGATTTTAGATTTTTGG - Intronic
918604859 1:186411170-186411192 CATTTCAGATTTTGGATTCTTGG + Intronic
919444533 1:197685740-197685762 GACTTCAGATTTTAAATTTTGGG - Intronic
919634791 1:199993026-199993048 CATTTCGGATTTTTTATTTTTGG + Intergenic
920943776 1:210509336-210509358 CATTTCAGATTTCAGATTTTTGG + Intronic
921016272 1:211194578-211194600 CATTTTGGATTTCAGATTTTTGG + Intergenic
921242956 1:213205915-213205937 CATTTCAGATTTGGGATTTTTGG - Intronic
922249049 1:223830309-223830331 CATTTCAGATTTCAGATTTTTGG + Intronic
922404190 1:225295116-225295138 CACTTCTGATTTTATTTATTTGG + Intronic
922535912 1:226380719-226380741 CATTTCAGATTTCAGAGTTTTGG - Intronic
922912427 1:229229060-229229082 CATTTTTGATTTTGGATTTTCGG + Intergenic
923183225 1:231543516-231543538 CATTTCGGATTTAGGATTTTTGG + Intronic
923204052 1:231740925-231740947 CATTTCAAATTTCAGATTTTTGG + Intronic
923235862 1:232032079-232032101 CATTTCAGATTTGGGATTTTTGG - Intronic
923235873 1:232032162-232032184 CATTTCAGATTTTGGATTTGGGG + Intronic
923394377 1:233546193-233546215 TACTTCCGGTTTTAGGTTTCTGG - Intergenic
923565252 1:235071606-235071628 CATTACGGATTTTGGATTTTTGG - Intergenic
923636975 1:235707929-235707951 CATATCAGATTTCAGATTTTTGG - Intronic
923688518 1:236171246-236171268 CATTTCGGATTTTGAATTTTTGG + Intronic
923836161 1:237613708-237613730 CATTTCGAATTTCAGATTTTTGG - Intronic
924200609 1:241654697-241654719 CATTTTAGATTTTGGATTTTGGG - Intronic
924895103 1:248329344-248329366 TACTTTGGATATTAGATTTTTGG + Intergenic
1063609341 10:7549986-7550008 CCCTTCAGAATTTATATTTTGGG + Intergenic
1063637916 10:7801831-7801853 CACTTCAGATTTTGGACTTTGGG + Intronic
1064256727 10:13748675-13748697 CATTTCTGATTTGGGATTTTGGG - Intronic
1064508193 10:16057135-16057157 CTCTTCCTAATTTATATTTTTGG - Intergenic
1064801124 10:19073427-19073449 CACTTTGGATTTCAGATTTTTGG - Intronic
1064825520 10:19394701-19394723 CATTTCAAATTTTGGATTTTTGG - Intronic
1065291446 10:24234199-24234221 CATTTCAGATTTTGGATTTTTGG + Intronic
1065367449 10:24950443-24950465 CATTTCGGATTTTGGATTTTTGG + Intronic
1065988839 10:30986694-30986716 CATTTTGGATTTCAGATTTTTGG - Intronic
1066409068 10:35148268-35148290 CATTTCAGATTTTGGATTTTTGG + Intronic
1066692227 10:38041676-38041698 CATTTCAGATTTTAGATTTCTGG + Intronic
1067000490 10:42606953-42606975 CATTTCAGATTTTAGATTTCTGG - Intronic
1067672859 10:48341357-48341379 CATTTCAGATTTCAGATGTTTGG - Intronic
1068407990 10:56617599-56617621 CATTTCCTATTTTTGATTTATGG + Intergenic
1068539765 10:58278732-58278754 CATTTCAGATTTCAAATTTTTGG - Intronic
1068566426 10:58580447-58580469 CATTTCAGATTTCAAATTTTTGG + Intronic
1068998586 10:63237805-63237827 TTTTTCAGATTTTAGATTTTTGG + Intronic
1069976567 10:72217883-72217905 CATTTTGAATTTTAGATTTTCGG + Intronic
1070921528 10:80189657-80189679 CATTTTGGATTTTGGATTTTTGG - Intronic
1071590398 10:86867167-86867189 CATTTCAGATTTCAGATTTTTGG - Intronic
1071710973 10:88049052-88049074 CATTTCAGAGTTTGGATTTTTGG + Intergenic
1071819595 10:89265877-89265899 CATTTTGGATTTTGGATTTTTGG - Intronic
1071864449 10:89711458-89711480 CATTCCCTATTTTAAATTTTGGG - Intronic
1072489616 10:95891422-95891444 CATTTCAGATTTCAGATTTTGGG - Intronic
1072985703 10:100138179-100138201 CTTTTCAGATTTCAGATTTTTGG - Intergenic
1073369774 10:102977309-102977331 CATTTCAGATTTTGGATTTTTGG - Intronic
1074292897 10:112154136-112154158 TACTTCAGATTTTTGATTTTGGG - Intronic
1074319229 10:112385819-112385841 CATTTCTGTTTATAGATTTTAGG + Intronic
1074349005 10:112716719-112716741 CACTTTGGATTTCTGATTTTTGG + Intronic
1074735588 10:116429078-116429100 AAGTTTAGATTTTAGATTTTTGG - Intronic
1075034950 10:119057294-119057316 CATTTCAGATTTTGGGTTTTTGG - Intronic
1075200356 10:120397638-120397660 CATTTTGGATTTTGGATTTTTGG + Intergenic
1075287511 10:121200158-121200180 CACTTCGGATTTTGAGTTTTTGG - Intergenic
1076621412 10:131790842-131790864 CATTTTAGATTTTAGACTTTTGG - Intergenic
1077723529 11:4650796-4650818 CATTTCAGATTTTGGATGTTTGG - Intronic
1077750421 11:4961702-4961724 CACTTGGGATTTTAATTTTTGGG + Intronic
1078263478 11:9734090-9734112 CATTTCCAATTTCAGACTTTTGG - Intronic
1078363455 11:10688024-10688046 CATTTCAGATTTTGGATTTTTGG + Intronic
1078765400 11:14292119-14292141 CATTTCAGATTTCAGATTTTTGG + Intronic
1078807848 11:14724527-14724549 CATTTCAGATTTTGGATATTTGG + Intronic
1078983632 11:16567026-16567048 CATTTTGGATTTCAGATTTTTGG - Intronic
1079026552 11:16952720-16952742 CATTTTAGATTTCAGATTTTGGG - Intronic
1079511305 11:21214199-21214221 CATTTCGGATTTCAAATTTTTGG - Intronic
1079524339 11:21366372-21366394 TCCTTCCCATTTTGGATTTTAGG + Intronic
1079706172 11:23622042-23622064 CATTTTAGATTTTAGATTCTTGG - Intergenic
1079962605 11:26942513-26942535 CATTTCCATTTTTACATTTTCGG + Intergenic
1080231796 11:30024519-30024541 CATTTTGGATTTTGGATTTTTGG - Intergenic
1080275529 11:30499372-30499394 CATTTCAGATTTTGGATTTTGGG - Intronic
1080566977 11:33518987-33519009 CATTTCAGATTTTGTATTTTTGG + Intergenic
1080632877 11:34095342-34095364 CACTTACAATTTTAAATTTTGGG + Intronic
1080732345 11:34970748-34970770 CTTTTCAGATTTTGGATTTTTGG + Intronic
1080899175 11:36471481-36471503 CATTTCAGATTTTCAATTTTTGG + Intergenic
1081501136 11:43667816-43667838 TATTTCAGATTTTGGATTTTTGG + Intronic
1081748575 11:45490233-45490255 CATTTCCGATTTCAGATTTTTGG - Intergenic
1081805717 11:45889321-45889343 CATTTCAGATTTCAGGTTTTTGG + Intronic
1084114545 11:67034375-67034397 CATTTTGGATTTCAGATTTTTGG + Intronic
1084737440 11:71114691-71114713 CACTTCTGATTCTAGATTTCAGG + Intronic
1084989989 11:72913678-72913700 CACTTCTGATTTTATTTATTTGG + Intronic
1085370544 11:75999826-75999848 CATTTCAGATTTCAGATTTTAGG + Intronic
1085433574 11:76479187-76479209 CATTTCAGATTTCAGATTTTCGG - Intronic
1085610526 11:77944677-77944699 CATTTTGGATTTCAGATTTTTGG - Intronic
1086290566 11:85304513-85304535 CATTTCAGATTTCAGATTTTGGG - Intronic
1087514738 11:99143650-99143672 CACTACTGATTTTACCTTTTTGG + Intronic
1087786290 11:102358253-102358275 CATTTTGGATTTTGGATTTTTGG - Intronic
1087928049 11:103943179-103943201 CATTTCAGAGTTTAGATTTTTGG - Intronic
1088018172 11:105085388-105085410 TATTTCTGATTTTAGGTTTTGGG - Intronic
1088018700 11:105092249-105092271 CATTTCAAATTTTAGGTTTTTGG - Intronic
1088021255 11:105122429-105122451 CATTTCAAATTTTAGGTTTTTGG - Intergenic
1088344016 11:108802243-108802265 CATTTCAGATTTCAGATTTTTGG - Intronic
1088405589 11:109473579-109473601 CATTTCTGATTTTAGTTATTTGG - Intergenic
1088478754 11:110271853-110271875 CATTTAGGATTTTGGATTTTTGG - Intronic
1088582422 11:111328902-111328924 AACTTTGGATTTTGGATTTTTGG - Intergenic
1088582427 11:111328986-111329008 CATTTCAAATTTCAGATTTTTGG + Intergenic
1088628538 11:111751450-111751472 CATTTCACATTTTGGATTTTTGG - Intronic
1088751408 11:112845031-112845053 CACTTTGGATTTTAGATTTTTGG - Intergenic
1089040047 11:115439217-115439239 CACTTACCCTTTTACATTTTGGG - Intronic
1089072743 11:115713212-115713234 CATTTGAGATTTCAGATTTTTGG - Intergenic
1089714769 11:120348408-120348430 CATTTCTGATTTTGGATTTTTGG - Intronic
1089961406 11:122620161-122620183 CATTTTGGATTTTGGATTTTGGG - Intergenic
1090813995 11:130274251-130274273 CATTTCAAATTTTACATTTTTGG + Intronic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1091506058 12:1069861-1069883 CTTTTTGGATTTTAGATTTTTGG + Intronic
1091572866 12:1705389-1705411 CATTTTAGATTTCAGATTTTTGG - Intronic
1091867130 12:3850323-3850345 GAATTCTGATTTCAGATTTTTGG - Intronic
1091896852 12:4111946-4111968 CATTTCAGATTTTGGATTTTTGG - Intergenic
1091978476 12:4846214-4846236 CATTTTGGATTTTGGATTTTGGG + Intronic
1092058793 12:5530838-5530860 CATTTTGGATTTCAGATTTTAGG - Intergenic
1092501779 12:9054805-9054827 CACTTTGGATGTCAGATTTTTGG - Intergenic
1092668042 12:10828559-10828581 CATTTCAAATTTCAGATTTTTGG + Intronic
1093185127 12:16011417-16011439 CATTTCACATTTCAGATTTTTGG - Intronic
1093869087 12:24264888-24264910 TACTCCAGATTTGAGATTTTTGG - Intergenic
1093956636 12:25228066-25228088 CATTTTGGATTTCAGATTTTTGG - Intronic
1094285546 12:28789138-28789160 CATTTCAGATTTCAGAGTTTTGG - Intergenic
1095234019 12:39775976-39775998 CATTTTGGATTTTAGATTTTTGG + Intronic
1095235928 12:39795758-39795780 GACTTCTGATTTTAAATTATTGG + Intronic
1095673416 12:44888454-44888476 CATTTCCGATTTTATTTATTTGG - Intronic
1095717886 12:45368218-45368240 CATTTCAGATTTTGGAGTTTTGG - Intronic
1095724663 12:45438398-45438420 CATTTTGGATTTCAGATTTTTGG - Intronic
1096481597 12:51945024-51945046 CATTTCAGATTTTTTATTTTTGG - Intergenic
1096577820 12:52565141-52565163 CACTTTGGATTTCAGACTTTTGG - Intergenic
1096989062 12:55783753-55783775 CTCTTCATATTTTAGATTTATGG - Intronic
1097071300 12:56356902-56356924 CATTTCAGATTTCAGAGTTTTGG - Intronic
1097711890 12:62926114-62926136 CAATTCCAATTTTGAATTTTTGG - Intronic
1097782494 12:63724102-63724124 CATTTCAGATTTTAGATTTGTGG - Intergenic
1098031877 12:66263476-66263498 CATTTCAGATTTCAGATCTTTGG + Intergenic
1098347082 12:69516949-69516971 CATTTCAGATTTCAAATTTTTGG - Intronic
1098383030 12:69889497-69889519 CATTTCAGATTTCAGATTTTTGG - Intronic
1098460552 12:70728668-70728690 CACTTTGGATTTTGGATTTTTGG + Intronic
1098560658 12:71867848-71867870 CATTTCAGATTTAAGATTTTTGG + Intronic
1098643413 12:72866976-72866998 CATTTCAGATTTCAGATTTTGGG + Intergenic
1099198313 12:79646125-79646147 CATTTAAGATTTTGGATTTTTGG - Intronic
1099230922 12:80024122-80024144 CACTTCATATTTTGGGTTTTTGG - Intergenic
1099871438 12:88354453-88354475 CTCTTTCGATATGAGATTTTAGG - Intergenic
1100071709 12:90728665-90728687 CACTCCAGATTTTAGATTTTTGG - Intergenic
1101179562 12:102199679-102199701 CATTTCAGATTTCAGATTTTGGG - Intergenic
1101232831 12:102758629-102758651 CATTTCAGATTTTGGATTTTGGG - Intergenic
1101260453 12:103024444-103024466 CATTTTGGATTTTAGATTTTTGG + Intergenic
1101484925 12:105146870-105146892 CATTTTGGATTTCAGATTTTCGG + Intronic
1101621137 12:106389665-106389687 CATTTCAGATTTTGGATTTCTGG - Intronic
1101669165 12:106850890-106850912 CATTTCTGATTTCAGATTCTAGG + Intronic
1101965789 12:109281158-109281180 CAGTTCAGATTTCAGATGTTTGG - Intronic
1102032209 12:109747061-109747083 TACTTTGGATTTTAGATTTGGGG + Intronic
1103121119 12:118380381-118380403 TATTTCAGATTTCAGATTTTTGG + Intronic
1103428380 12:120859234-120859256 CATTTTGGATTTTGGATTTTTGG - Intronic
1103538070 12:121647154-121647176 CACTTTCTATATTAGATGTTTGG - Intergenic
1103643912 12:122375716-122375738 CCCTTCTGATTTTTAATTTTTGG - Intronic
1104112335 12:125715918-125715940 CACTCTCAGTTTTAGATTTTCGG - Intergenic
1105500001 13:20963596-20963618 CATTTCAAATTTCAGATTTTCGG - Intergenic
1105979794 13:25506874-25506896 CATTTCAAATTTCAGATTTTCGG + Intronic
1105991162 13:25622561-25622583 CATTTCGGATTTTGGATTTTTGG - Intronic
1106019843 13:25904190-25904212 CATTTCAGATTTCACATTTTTGG + Intronic
1106368254 13:29105091-29105113 CATTTTGGATTTTGGATTTTGGG + Intronic
1106418058 13:29562377-29562399 CATTTCAGATTTTGGATTTTTGG - Intronic
1106799775 13:33244114-33244136 CATTTCAGATTTTGGAGTTTTGG + Intronic
1107109345 13:36679186-36679208 CATTTCAGACTTTGGATTTTTGG - Intronic
1107223443 13:38016274-38016296 CATTTTGGATTTCAGATTTTTGG - Intergenic
1107315001 13:39121158-39121180 CATTTCAGATTTTTCATTTTTGG - Intergenic
1107538435 13:41360287-41360309 CATTTTGGATTTTGGATTTTTGG + Intronic
1108078481 13:46707881-46707903 CACTTACGAGTTTACATTCTAGG + Intronic
1108085062 13:46779393-46779415 CATTTCTGATTTTGGATTTTTGG - Intronic
1108312221 13:49205538-49205560 CATTTCCAATTTCAGATTTTTGG + Intronic
1108558579 13:51620772-51620794 CACTTCCCATTTAGGATTCTGGG - Intronic
1108753363 13:53471738-53471760 CACTTTCGATTTTAAAACTTTGG - Intergenic
1108908879 13:55517348-55517370 CAATTTCTGTTTTAGATTTTGGG + Intergenic
1109210121 13:59525513-59525535 GATTTCAGATTTTAGATTTTTGG + Intergenic
1109386936 13:61642556-61642578 TATTTCAGATTTTAGATTTTGGG + Intergenic
1109410011 13:61951144-61951166 CATTTCAAATTTCAGATTTTTGG - Intergenic
1109691343 13:65894506-65894528 TATTTCAGATTTTAAATTTTTGG + Intergenic
1109889950 13:68598170-68598192 CATTTCAGATTTCAGATTTTGGG + Intergenic
1110394449 13:75013080-75013102 CACTTCTCATTTTAAATATTAGG - Intergenic
1110404520 13:75134721-75134743 CATTTGGGATTTTGGATTTTTGG + Intergenic
1110446737 13:75591986-75592008 CATTTGAGATTTCAGATTTTTGG + Intronic
1110615149 13:77533275-77533297 CATTTGAGATTTTAAATTTTAGG + Intergenic
1110911595 13:80972400-80972422 CATTTTGGATTTCAGATTTTTGG + Intergenic
1111144484 13:84163126-84163148 CACTTCAGATTTTAGGACTTGGG - Intergenic
1111280915 13:86023675-86023697 CATTTCAGATTTCACATTTTTGG - Intergenic
1111311401 13:86491341-86491363 CACTTTGGATTTCAAATTTTTGG + Intergenic
1111983255 13:95039225-95039247 CATTTCAGATTTTGGATTTTCGG - Intronic
1112265176 13:97917329-97917351 CATTTCAGATTTTGAATTTTGGG - Intergenic
1112265183 13:97917412-97917434 CATTTTGGATTTCAGATTTTTGG + Intergenic
1112902486 13:104375020-104375042 CATTTCAGATTTCCGATTTTTGG + Intergenic
1113446179 13:110369281-110369303 CCCTTCAGATTTTGGATTTTTGG - Intronic
1115178268 14:30591042-30591064 CATTTTGGATTTTAGATTTTTGG + Intronic
1115563520 14:34604720-34604742 TACTTTGGATTTCAGATTTTCGG - Intronic
1115713403 14:36075135-36075157 CATTTCATATTTTAGATCTTAGG - Intergenic
1115732865 14:36290354-36290376 CATTTCAGATTTCTGATTTTGGG - Intergenic
1115981934 14:39062319-39062341 CATTTTGGATTTTGGATTTTTGG - Intronic
1116410908 14:44622348-44622370 CATTTCAGATTTCAGATTTTTGG - Intergenic
1116926633 14:50645298-50645320 CATTTCAAATTTCAGATTTTTGG - Intronic
1116967876 14:51032941-51032963 CACTTCAGATTTCAGATTTTTGG + Intronic
1117154194 14:52921774-52921796 CATTTCAGATTTCAGATTTTTGG + Intronic
1117155061 14:52930970-52930992 CTCTTTCGATTTTAGAGTTGGGG + Intronic
1117393731 14:55288033-55288055 CATTTCGGATTTCGGATTTTTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117813369 14:59571872-59571894 CATTTCAGTTTTCAGATTTTTGG - Intronic
1118624055 14:67640895-67640917 CATTTCCGATTTTGGATTTCTGG - Intronic
1118633925 14:67730502-67730524 TATTTCGGGTTTTAGATTTTTGG + Intronic
1118933908 14:70268627-70268649 GAATTCCAATTTTAGATATTAGG + Intergenic
1118946188 14:70389640-70389662 CATTGCAGATTTCAGATTTTTGG - Intronic
1118946195 14:70389723-70389745 CATTTCAAATTTCAGATTTTTGG + Intronic
1119610961 14:76061848-76061870 GATTTCAGATTTTGGATTTTGGG - Intronic
1119794187 14:77380890-77380912 CACTCCCTAGTTTAGAATTTAGG + Intronic
1119815991 14:77568043-77568065 CATTTTAGATTTCAGATTTTGGG + Intronic
1120390175 14:83896993-83897015 CATTTCCAATTTCAGATTTCTGG - Intergenic
1121187336 14:91986396-91986418 CATTTTGGATTTTGGATTTTTGG - Intronic
1121862115 14:97328143-97328165 CATTTTGGATTTCAGATTTTGGG - Intergenic
1121958992 14:98240982-98241004 CATTTCAGATTTTGGATTTTGGG - Intergenic
1122620058 14:103051197-103051219 CACTTCTGATTTTAGATTTAAGG + Intronic
1122713148 14:103675488-103675510 CAGTTCAGATTTTGGAGTTTTGG + Intronic
1202839289 14_GL000009v2_random:106379-106401 CATTTGGGATTTCAGATTTTTGG + Intergenic
1202908665 14_GL000194v1_random:96532-96554 CATTTGGGATTTCAGATTTTTGG + Intergenic
1202884590 14_KI270722v1_random:92785-92807 CATTTGGGATTTCAGATTTTTGG - Intergenic
1123460771 15:20468369-20468391 CATTTCAGATTTTGGATTTTGGG + Intergenic
1123657290 15:22532047-22532069 CATTTCAGATTTTGGATTTTGGG - Intergenic
1123726171 15:23103591-23103613 CATTACAGATTTCAGATTTTTGG + Intergenic
1124087434 15:26564142-26564164 CATTTCAGATTTTGGATTTTTGG + Intronic
1124209099 15:27747468-27747490 CACTGCTGGTTTTAGATGTTGGG + Intergenic
1124271410 15:28284161-28284183 CATTTCAGATTTTGGATTTTGGG + Intronic
1124311202 15:28627256-28627278 CATTTCAGATTTTGGATTTTGGG - Intergenic
1124452615 15:29810048-29810070 CATTTCAGATTTCAGATTTTTGG - Intronic
1124692436 15:31836023-31836045 CATTTCAGATTTCAGATCTTTGG + Intronic
1124890586 15:33728693-33728715 CATTTCAGGTTTCAGATTTTTGG + Intronic
1125451393 15:39811560-39811582 CATTTTGGATTTTGGATTTTTGG - Intronic
1126055641 15:44727448-44727470 CATTTAGGATTTCAGATTTTTGG + Intergenic
1126269354 15:46795708-46795730 CATTTCTGATTTTATATATTTGG - Intergenic
1127012744 15:54648374-54648396 CATTTCCGATTTTATTTATTTGG - Intergenic
1127091913 15:55475593-55475615 CATTTTGGATTTCAGATTTTTGG - Intronic
1127104885 15:55603128-55603150 CATTTTGGATTTCAGATTTTTGG - Intergenic
1127239849 15:57101149-57101171 TATTTGTGATTTTAGATTTTAGG + Intronic
1127413122 15:58729606-58729628 CATTTTGGATTTCAGATTTTTGG - Intronic
1127431891 15:58918819-58918841 AACTTCTAATTTTAGATTTTAGG - Intronic
1127939246 15:63677067-63677089 CATTTCAGATTTGGGATTTTTGG - Intronic
1127939259 15:63677171-63677193 CACTTTGGATTTTGGATTTTTGG + Intronic
1128498902 15:68213725-68213747 CATTTCAGATTTCAGATTTTTGG + Intronic
1128567770 15:68712473-68712495 CATTTCAGATTTTGGATTTGGGG + Intronic
1128840418 15:70846153-70846175 CACCTCCCATGTTATATTTTAGG + Intronic
1129495920 15:75980437-75980459 TAGTTCAGATTTTAGACTTTTGG - Intronic
1129647062 15:77445905-77445927 AACTTCCCATTTAATATTTTTGG + Intronic
1129832569 15:78680354-78680376 CATTTCCAATTTCGGATTTTCGG - Intronic
1129855784 15:78824026-78824048 CATTTCAGATTTTGGATTTTTGG - Intronic
1130280533 15:82516806-82516828 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130471904 15:84232989-84233011 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130479398 15:84347560-84347582 CATTTCAGATTTTGGATTTTCGG - Intergenic
1130492372 15:84440569-84440591 CATTTCAGATTTTGGATTTTCGG + Intergenic
1130594201 15:85237626-85237648 CATTTCAGATTTTGGATTTTCGG - Intergenic
1131312281 15:91301871-91301893 CATTTCGGATTTTTGACTTTTGG + Intergenic
1131380619 15:91960836-91960858 CATTTCAGATTTTGGATTTTTGG - Intronic
1131381994 15:91972038-91972060 CATTTCAGATTTTGGATTTTTGG + Intronic
1131521587 15:93120192-93120214 CATTTTCAATTTCAGATTTTCGG + Intergenic
1132174065 15:99694443-99694465 CATTTTGGATTTCAGATTTTTGG - Intronic
1134059562 16:11191012-11191034 CACTGCCGACTTCAGATTTTAGG - Intergenic
1134222234 16:12363863-12363885 TACCTCAGATTTCAGATTTTTGG - Intronic
1134222243 16:12363940-12363962 CATTTTGGATTTCAGATTTTAGG + Intronic
1134357375 16:13495634-13495656 CATTTCTGATTTTAAATATTTGG + Intergenic
1135344401 16:21676247-21676269 CACTTCGGATTTTACATTGCTGG + Intergenic
1135467483 16:22699708-22699730 CATTTCTAATTTCAGATTTTTGG - Intergenic
1135849987 16:25954658-25954680 CATTTTGGATTTTGGATTTTTGG - Intronic
1135867401 16:26116873-26116895 CATTTCAGATTTGGGATTTTGGG + Intronic
1136633589 16:31504593-31504615 CATTTCAGATTTTAGGTTTTTGG - Intronic
1137836891 16:51600850-51600872 CACTTCTGATTTCAGATTTTTGG - Intergenic
1137860356 16:51840664-51840686 CATTTCTGATTTTGGACTTTTGG - Intergenic
1137919067 16:52467766-52467788 CATTTCCTATTATTGATTTTGGG - Intronic
1137926051 16:52543312-52543334 CATTTCGGATTTCAGATTTTTGG - Intronic
1137964755 16:52919628-52919650 CATTTTGGATTTCAGATTTTTGG - Intergenic
1138241733 16:55432969-55432991 AACTTCTGATTTTGGATGTTCGG - Intronic
1138920313 16:61520169-61520191 CATTTCAGATTTTGGATTTTGGG - Intergenic
1138929775 16:61638943-61638965 TACTTCAGATTTCAGATTCTTGG + Intergenic
1139162097 16:64522543-64522565 CATTTCTGTTTTTAGATCTTTGG - Intergenic
1139416883 16:66819727-66819749 CATTTCTGATTTTGGATTTTTGG + Intronic
1139432169 16:66916756-66916778 TATTTCAGATTTCAGATTTTCGG - Intronic
1139784689 16:69383270-69383292 CATTTGGGATTTCAGATTTTTGG + Intronic
1139815712 16:69669252-69669274 CATTTAAGATTTTAGATTTTTGG + Intronic
1139818303 16:69695725-69695747 CATTTTGGATTTTGGATTTTTGG - Intronic
1140486528 16:75297943-75297965 GACTTCAGATTTCGGATTTTTGG - Intronic
1140489487 16:75322632-75322654 CATTTTAGATTTCAGATTTTTGG - Intronic
1140685358 16:77428661-77428683 CATTTCAGATTTCAAATTTTTGG - Intronic
1141967505 16:87456227-87456249 CATTTTAGAATTTAGATTTTAGG + Intronic
1142829605 17:2538484-2538506 CATTTCGGGTTTCAGATTTTGGG - Intergenic
1142829612 17:2538566-2538588 CATTTCAGATTTTGAATTTTTGG + Intergenic
1143296519 17:5875531-5875553 CATTTCAGATTTTGGATTTTTGG - Intronic
1143465944 17:7136518-7136540 CCTTTCGGATTTTGGATTTTGGG - Intergenic
1143928829 17:10399131-10399153 CATTTCAGATTTTAGATTTTCGG - Intronic
1144676100 17:17162709-17162731 CATTTCAGATTTTCGAATTTGGG - Intronic
1144676107 17:17162788-17162810 CATTTCAGATTTTGGATTTTTGG + Intronic
1144942935 17:18953794-18953816 CATCTCAGATTTTAGAGTTTTGG + Intronic
1145106220 17:20119942-20119964 CATTTTGGATTTTGGATTTTTGG + Intronic
1146201525 17:30862823-30862845 CATTTCAAATTTCAGATTTTTGG - Intronic
1146360600 17:32173416-32173438 CATTTCAGATTTCAGATTCTGGG + Intronic
1147010040 17:37438361-37438383 CACTTTCGTTTTTATCTTTTGGG + Intronic
1147126949 17:38377348-38377370 CACTTTGGATTTCAGAGTTTTGG + Intronic
1148916200 17:50981096-50981118 CATTTCAGATTTCAGATTTTTGG - Intronic
1149274968 17:55023586-55023608 CATTTTCGATTTCGGATTTTTGG + Intronic
1149402361 17:56311406-56311428 CATTTTGGATTTTGGATTTTTGG - Intronic
1149750173 17:59138383-59138405 CATTTCAGATTTTGGAATTTTGG + Intronic
1149933377 17:60779096-60779118 CATTTTGGATTTTGGATTTTCGG - Intronic
1150193193 17:63265227-63265249 CATTTCATATTTCAGATTTTTGG + Intronic
1150306460 17:64089378-64089400 CATTTCAGATTTTGGATTTTCGG - Intronic
1150355700 17:64482781-64482803 CATTTAAGATTTTGGATTTTTGG + Intronic
1150751313 17:67865199-67865221 CATTTTGGATTTCAGATTTTCGG + Intronic
1151647833 17:75445694-75445716 CTCTTCCAATTCTAAATTTTTGG + Intronic
1153234600 18:2973924-2973946 CATTTTGGATTTCAGATTTTTGG + Intronic
1153651708 18:7247034-7247056 GATTTCAGATTTCAGATTTTTGG - Intergenic
1154015825 18:10616199-10616221 CATTTCAGATTTCAAATTTTTGG - Intergenic
1154015834 18:10616282-10616304 CATTTTGGATTTCAGATTTTTGG + Intergenic
1154189677 18:12219360-12219382 CATTTTGGATTTCAGATTTTTGG - Intergenic
1154189686 18:12219443-12219465 CATTTCAGATTTCAAATTTTTGG + Intergenic
1154275869 18:12959583-12959605 CATTTCAGATTTCAGATTTTTGG + Intronic
1154308683 18:13250516-13250538 CACTTCTGATTTTATTTATTTGG - Intronic
1154931677 18:21003864-21003886 TGCTTCAGATTTTGGATTTTGGG - Intronic
1155143243 18:23062406-23062428 CATTTCAGATTTGGGATTTTGGG - Intergenic
1155222414 18:23697548-23697570 CATTTGGGATTTTGGATTTTTGG - Intronic
1155465107 18:26125801-26125823 CACTTCAGATTTTGTATTTTTGG - Intergenic
1156327967 18:36091588-36091610 CATTTTAGATTTTGGATTTTTGG + Intergenic
1156346471 18:36261212-36261234 CATTTCAGATTTCAGATTTTTGG - Intronic
1156876599 18:42021727-42021749 CATTTCAGATTTCAAATTTTTGG - Intronic
1156876604 18:42021810-42021832 CATTTCAGATTTTGAATTTTTGG + Intronic
1156877779 18:42036827-42036849 CATTTTAGATTTTGGATTTTTGG - Intronic
1156882217 18:42094230-42094252 CACTTCGGATTTTTGGATTTGGG + Intergenic
1157316016 18:46590407-46590429 CTCTCACGATTTTAGATTCTCGG - Intronic
1157667286 18:49498573-49498595 CATTTCGGATTTCAGATTTTCGG + Intergenic
1157679419 18:49592592-49592614 CATTTCGGATTTTGGATTTTTGG + Exonic
1157721574 18:49929264-49929286 CTTTTCAGATTTCAGATTTTTGG - Intronic
1158089775 18:53697073-53697095 CATTTGCGATTTTGAATTTTTGG + Intergenic
1158671921 18:59483411-59483433 CATTTCAGATTTCAGATTTTTGG - Intronic
1158951965 18:62503407-62503429 CATTTCAGATTTTAGATTTTCGG - Intergenic
1159378279 18:67622591-67622613 CATTTCTGATTTCAGATTCTGGG - Intergenic
1159520829 18:69520498-69520520 CATTTTCGATTTTAGACTTTTGG - Intronic
1159554251 18:69928677-69928699 CATTTTAGATTTCAGATTTTTGG - Intronic
1159570696 18:70109228-70109250 CATTTCAGATTTTGGATTTTTGG - Intronic
1159699099 18:71602056-71602078 CACTTCAAGTTTTAAATTTTTGG - Intergenic
1159801607 18:72907110-72907132 CATTTCAGATTTCATATTTTTGG - Intergenic
1159803928 18:72931739-72931761 CAATTCAGACTTTAAATTTTGGG - Intergenic
1159975586 18:74707571-74707593 CATTTTGGATTTCAGATTTTTGG + Intronic
1160466842 18:79084486-79084508 CACTTCCCAATTTAAACTTTGGG + Intronic
1160487210 18:79304517-79304539 CATTTCCAATTTTAGATTTTTGG + Intronic
1160555793 18:79724062-79724084 CATTCCCAATTTTGGATTTTCGG - Intronic
1161776468 19:6265314-6265336 CATTTTAGATTTTGGATTTTTGG - Intronic
1161917550 19:7240617-7240639 CATTTAAGATTTTGGATTTTGGG - Intronic
1161917557 19:7240657-7240679 CATTTAGGATTTTGGATTTTCGG - Intronic
1163146483 19:15382613-15382635 CATTTCAGATTTTGGGTTTTTGG - Intronic
1163298367 19:16427421-16427443 AATTTCAGATTTTGGATTTTTGG - Intronic
1163369788 19:16895663-16895685 CATTTCAGATTTAGGATTTTTGG - Intronic
1164106794 19:22114240-22114262 CACTTCCCAGTTTAGATAATTGG + Intergenic
1164497109 19:28776484-28776506 CATTTCTGATTGTAGGTTTTTGG - Intergenic
1165672354 19:37690043-37690065 CATTTCAGATTTTGGAGTTTTGG - Intronic
1166270869 19:41712943-41712965 CATTTCAGATTTTGGATTTTAGG - Intronic
1166276842 19:41759861-41759883 CATTTCAGATTTTGGATTATTGG - Intronic
1166623725 19:44330124-44330146 CATTTCACATTTCAGATTTTTGG - Intronic
1167732168 19:51266245-51266267 CATTTCGGATTTTGGATTTTTGG - Intronic
1168463957 19:56587161-56587183 CACTTCCCAGTTTAAATTGTAGG + Intronic
1168596344 19:57681130-57681152 CATTTTGGATTTTAGATTTTTGG - Intergenic
1168633111 19:57972618-57972640 CACATCCCATCTTAGATATTTGG - Intronic
1202633746 1_KI270706v1_random:24156-24178 CATTTGGGATTTCAGATTTTTGG - Intergenic
1202652138 1_KI270707v1_random:15900-15922 CATTTGGGATTTCAGATTTTTGG + Intergenic
1202660001 1_KI270708v1_random:59813-59835 CATTTGGGATTTCAGATTTTTGG - Intergenic
1202687924 1_KI270712v1_random:64218-64240 CACTTCCCATCTTAGCTTCTGGG - Intergenic
925813857 2:7727987-7728009 CACTTCAGATTTTGGATTTTGGG - Intergenic
925936159 2:8763370-8763392 CATTTGGGATTTTGGATTTTTGG - Intronic
926522827 2:13938067-13938089 CAATTCTGATTTCAGATTTCTGG - Intergenic
927449602 2:23196323-23196345 CATTTCAGATTTCAGATTTTTGG + Intergenic
927466402 2:23339964-23339986 CATTTCAGATTTTGGATTTTTGG + Intergenic
927535697 2:23856375-23856397 CATTTCAGATTTCAGATTTTTGG + Intronic
927784226 2:25961476-25961498 CAATTACAATTTTACATTTTGGG + Intronic
928014064 2:27637706-27637728 CATTTCAGATTTCAAATTTTTGG - Intronic
928055188 2:28045956-28045978 CAGTTACTATTTTAGCTTTTAGG - Intronic
928120962 2:28583151-28583173 CATTTCAGATTTCAGATTTTCGG - Intronic
928177624 2:29045747-29045769 CATTTCCGATTTCAGATTTTTGG + Intronic
928393949 2:30930030-30930052 CATTTTGGATTTTAGATTTTTGG + Intronic
928557039 2:32437658-32437680 CATTTCATATTTTGGATTTTTGG - Intronic
928642759 2:33318064-33318086 CATTGCAGATTTTAGATTTTTGG + Intronic
928769132 2:34684931-34684953 CATTTTGGATTTCAGATTTTTGG + Intergenic
928957980 2:36891058-36891080 CATTTTGGATTTTGGATTTTTGG - Intronic
929942967 2:46348788-46348810 CATTTCAAATTTCAGATTTTTGG - Intronic
930779360 2:55208447-55208469 CATTTCAGATTTCAAATTTTTGG + Intronic
931336676 2:61352180-61352202 CAGTTCAAATTTTAGAGTTTTGG + Intronic
931533487 2:63244958-63244980 CACTTCAGATTTTGGATTTTTGG - Intronic
931675725 2:64694318-64694340 CATTTTGGATTTCAGATTTTTGG - Intronic
931983589 2:67720536-67720558 CATTTCAGATTTCAGATTTTTGG + Intergenic
932033116 2:68210788-68210810 CATTTTGGATTTTGGATTTTTGG - Intronic
932596715 2:73098229-73098251 CATTTCAGATTTCAGATTTTTGG - Intronic
932640666 2:73442240-73442262 CATTTTGGATTTCAGATTTTTGG + Intronic
933230829 2:79805498-79805520 CATTTCAGATTTCAGATTTATGG + Intronic
933447270 2:82397956-82397978 CATTTTAGATTTCAGATTTTTGG - Intergenic
933460039 2:82570878-82570900 CACTTCTTGTTTTAGATCTTGGG - Intergenic
933932310 2:87165942-87165964 CATTTTGGATTTTGGATTTTCGG + Intergenic
933958427 2:87391369-87391391 CACTTCCCATCTTAGCTTCTGGG + Intergenic
934242555 2:90283288-90283310 CACTTCCCATCTTAGCTTCTGGG + Intergenic
934270621 2:91533390-91533412 CACTTCCCATCTTAGCTTCTGGG - Intergenic
934751141 2:96794914-96794936 CATTTGGGATTTTGGATTTTTGG - Intronic
934802072 2:97173854-97173876 CACATCAGATTTTTGTTTTTTGG + Intronic
934865682 2:97808258-97808280 CATTTTGGATTTCAGATTTTTGG + Intronic
934938567 2:98482933-98482955 CATTTTGGATTTCAGATTTTTGG + Intronic
934986471 2:98890693-98890715 CATTTCAGATTTAGGATTTTTGG - Intronic
936120493 2:109738667-109738689 CACTTCTGATTTTATTTATTTGG + Intergenic
936224202 2:110632779-110632801 CACTTCTGATTTTATTTATTTGG - Intergenic
936265538 2:111002949-111002971 CATTTCAGATTTCATATTTTTGG + Intronic
936360803 2:111799493-111799515 CATTTTGGATTTTGGATTTTCGG - Intronic
936381517 2:111990790-111990812 CATTTCAGATTTCAGATTTTGGG + Intronic
936545594 2:113390052-113390074 CTGTCCCGTTTTTAGATTTTTGG + Intergenic
937330985 2:121029664-121029686 CACTTCAGATTTTGGATTTTCGG + Intergenic
938879930 2:135575128-135575150 CACTTCAGATTTTGGATTAAGGG + Intronic
939642597 2:144659313-144659335 CATTTCAGATTTTCAATTTTTGG + Intergenic
939927077 2:148188121-148188143 CATTTCAGATTTTGGATTTTTGG + Intronic
940681759 2:156794647-156794669 CAAGTTTGATTTTAGATTTTAGG - Intergenic
940824244 2:158392491-158392513 TATTTCAGATTTTAGATTTTTGG + Intronic
941632272 2:167897819-167897841 CGTTTCAGATTTTGGATTTTTGG + Intergenic
941799840 2:169646667-169646689 CTGTTCCAATTTTAAATTTTCGG - Intronic
941929436 2:170925436-170925458 CACTTTGGATTTTGGATTTTTGG + Intergenic
942082000 2:172409024-172409046 CACTTACTATTTTTGTTTTTAGG + Intergenic
942435678 2:175972384-175972406 CATTTTGGATTTTGGATTTTTGG - Intronic
942629190 2:177937697-177937719 CTCTTCCCATTGTAGGTTTTTGG - Intronic
943036736 2:182756097-182756119 CATTTCAGATTTAAGATTTTTGG - Intronic
943172505 2:184421058-184421080 CATTTCATACTTTAGATTTTTGG + Intergenic
943204106 2:184869065-184869087 CATTTCGGATTTTGGATTTTCGG + Intronic
943633812 2:190283026-190283048 CATTTCAGATTTCAGAGTTTTGG - Intronic
944270580 2:197781225-197781247 CACTTTCTATGTTAGAATTTAGG - Intronic
944406181 2:199386213-199386235 CATTTCAGATTTTGAATTTTTGG - Intronic
944723793 2:202449418-202449440 CATTTAGGAATTTAGATTTTGGG + Intronic
945131167 2:206574214-206574236 CATTTCTGATCTTAGATTTTTGG + Intronic
945147101 2:206749859-206749881 CATTTCAGATTTCTGATTTTTGG + Intronic
945312257 2:208327805-208327827 CACTTTAGAATTTAGATTTCTGG + Intronic
945436427 2:209823870-209823892 CATTTTAGATTTCAGATTTTTGG - Intronic
945450967 2:209994662-209994684 CATTTTGGATTTCAGATTTTTGG + Intronic
945590341 2:211721250-211721272 CATTTCAGATTTTGGATTTTTGG + Intronic
945629491 2:212255576-212255598 AGCTTCAGATTTTAGGTTTTTGG + Intronic
945640259 2:212417391-212417413 CATTTCAGATTTTAGATTTTTGG - Intronic
945712044 2:213309140-213309162 CATTTCAGATTTTGGATTTTCGG + Intronic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
945777263 2:214121668-214121690 CATTTTGGAGTTTAGATTTTTGG - Intronic
946059414 2:216928873-216928895 CACTTTGGATTTCAGATTTTTGG - Intergenic
946129668 2:217596492-217596514 CACTTCAAGTTTTGGATTTTTGG - Intronic
946129675 2:217596575-217596597 CATTTCAGATTTTGGATTTTTGG + Intronic
946264114 2:218523426-218523448 CATTTCAGATTTCAGATTTTTGG + Intronic
946503865 2:220278422-220278444 CATTTAGGATTTTAGATTTTTGG + Intergenic
946549199 2:220782082-220782104 CTCTTCCTATTTTACATATTAGG - Intergenic
946725059 2:222654197-222654219 CATGTCAGATTTCAGATTTTTGG - Intronic
946917784 2:224543621-224543643 CATCTCAGATTTTGGATTTTCGG - Intronic
947685942 2:232084393-232084415 CATTTCAGATTTCAGATTTTAGG - Intronic
947878448 2:233483697-233483719 CATTTCAGATTTCAAATTTTTGG + Intronic
947880647 2:233507998-233508020 CATTTTGGATTTTGGATTTTGGG + Intronic
948116430 2:235496819-235496841 CCTTTGCGATTTGAGATTTTAGG + Intronic
948176701 2:235949204-235949226 CCCTTCGGATTTTGGATTTTGGG - Intronic
948496650 2:238354421-238354443 CAATTCCGATTTAGGATTGTAGG + Intronic
948774975 2:240281459-240281481 CATTTCCGATTTTATTTATTTGG - Intergenic
1169662157 20:7991557-7991579 CATTTTGGATTTTGGATTTTTGG + Intronic
1170179042 20:13508367-13508389 CATTTCAGCTTTTAGATTTTTGG - Intronic
1170235391 20:14097978-14098000 CATTTCGGATATTGGATTTTTGG + Intronic
1170238836 20:14139774-14139796 CATTTCAGATTTTGGATTTTTGG - Intronic
1170248850 20:14256791-14256813 CACTGCAGATTCTAGATATTTGG + Intronic
1170788022 20:19484436-19484458 CATTTCAGATTTCAGATTTTTGG + Intronic
1171047866 20:21827794-21827816 TACTTCCGATCTGAAATTTTGGG + Intergenic
1171169767 20:23005519-23005541 CATTTCAGATTTTAAATTTTTGG - Intergenic
1171500039 20:25585946-25585968 CATTTCGGATTTCAGATGTTTGG - Intergenic
1172438130 20:34944886-34944908 CATTTCAGCTTTTGGATTTTTGG + Intronic
1172985348 20:38983086-38983108 CACCTACGTTTTTATATTTTTGG + Intronic
1173090255 20:39964057-39964079 CACTTCTGATATTAGATGTGTGG + Intergenic
1173189679 20:40866453-40866475 CATTTCAGATTTCAGATGTTTGG - Intergenic
1173375579 20:42479663-42479685 TATTTCAGATTTCAGATTTTTGG - Intronic
1173719831 20:45246598-45246620 CATTTCAGATTTCAGATTTCTGG - Intergenic
1174601033 20:51725018-51725040 CATTTTGGATTTCAGATTTTTGG - Intronic
1174721914 20:52821928-52821950 GACTTTGGATTTTGGATTTTTGG + Intergenic
1176600016 21:8783753-8783775 CATTTGGGATTTCAGATTTTTGG - Intergenic
1176645962 21:9350012-9350034 CATTTGGGATTTCAGATTTTTGG - Intergenic
1177315238 21:19451841-19451863 CATTTCAGATTTTGGATTTTTGG - Intergenic
1177330974 21:19662275-19662297 CATTTCAGATTTCAAATTTTGGG - Intergenic
1177331632 21:19672475-19672497 TACTTCAGATTTTGTATTTTTGG + Intergenic
1178979775 21:37253823-37253845 CATTTCGGATTCTGGATTTTTGG + Intronic
1179203310 21:39247392-39247414 CATTTCAGATTTTGGATTTTTGG - Intronic
1180206125 21:46261822-46261844 CATTTTGGATTTCAGATTTTTGG - Intronic
1180327478 22:11443394-11443416 CATTTGGGATTTCAGATTTTTGG - Intergenic
1180366964 22:11949141-11949163 CATTTGGGATTTCAGATTTTTGG + Intergenic
1180379122 22:12122217-12122239 CATTTGGGATTTCAGATTTTTGG - Intergenic
1180418404 22:12791108-12791130 CATTTGGGATTTCAGATTTTTGG + Intergenic
1181625965 22:24122394-24122416 CATTTTGGATTTCAGATTTTTGG - Intronic
1181961726 22:26626662-26626684 TATTTCAGATTTTGGATTTTTGG - Intronic
1182214597 22:28705428-28705450 CATTTTGGATTTCAGATTTTTGG + Intronic
1182790537 22:32949055-32949077 CATTTCAGATTTTGGATTTTGGG - Intronic
1184252763 22:43270045-43270067 CATTTCAGATTCTGGATTTTCGG - Intronic
1184517011 22:44968750-44968772 CATTTTGGATTTTGGATTTTGGG - Intronic
1184815452 22:46865447-46865469 CATTTCAGATTTTAGATTTTTGG - Intronic
949313898 3:2730368-2730390 CATTTCAGATTTTGGATTTTTGG + Intronic
949502036 3:4689483-4689505 CATTTCATATTTTAGATGTTTGG + Intronic
949659735 3:6264737-6264759 CATTTCAGGTTTCAGATTTTTGG - Intergenic
950347731 3:12313475-12313497 CATTTTGGATTTTGGATTTTTGG + Intronic
951052118 3:18105674-18105696 TATTTCAGATTTCAGATTTTTGG + Intronic
951831911 3:26939676-26939698 CACTTCCAATTTTAAATTAATGG - Intergenic
951918231 3:27824103-27824125 CACTTCCTGTTTTATATATTAGG + Intergenic
952149362 3:30570626-30570648 CATTTCCGATTTTATTTATTTGG - Intergenic
952432044 3:33233292-33233314 CATTTCGAATTTTGGATTTTTGG + Intergenic
952440092 3:33317807-33317829 CATTTCAGATTTCTGATTTTTGG - Intronic
952440096 3:33317888-33317910 CATTTTAGATTTCAGATTTTTGG + Intronic
953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG + Intergenic
953258069 3:41308759-41308781 CATTTCAGATTTCAGATTTTTGG + Intronic
953294342 3:41698253-41698275 CATTTCAGATTTTAGATTTTTGG - Intronic
953299693 3:41760514-41760536 CATTACAGATTTCAGATTTTTGG - Intronic
953334763 3:42085089-42085111 CATTTCAGATTTCAGATTTTTGG + Intronic
953777392 3:45832433-45832455 CATTTCAGATTTCAGATTTTTGG + Intronic
953945709 3:47145651-47145673 CATTTCAGATTTCACATTTTTGG + Intronic
955017103 3:55081782-55081804 CATTTCAGGTTTTGGATTTTTGG + Intergenic
955818164 3:62869094-62869116 CACTTTGGATTTCAGATTTTTGG - Intronic
955835522 3:63050322-63050344 CATTTCAAATTTCAGATTTTTGG + Intergenic
956628515 3:71290797-71290819 CATTTCAGATTTGGGATTTTGGG + Intronic
957094232 3:75763432-75763454 CATTTGGGATTTCAGATTTTTGG + Intronic
957475704 3:80721166-80721188 CACCTCCGATTCAAGATTCTGGG + Intergenic
957590429 3:82190203-82190225 CACTTCTGATTTTTTGTTTTAGG + Intergenic
958427032 3:93990610-93990632 CATTTCAGATTCCAGATTTTTGG + Intronic
958507998 3:95006386-95006408 CATTTTGGATTTTAGATTTTGGG - Intergenic
959560297 3:107772024-107772046 CATTTCGGATTTCTGATTTTTGG + Intronic
959845372 3:111026492-111026514 CACTTCAGATTTCGGATTTTTGG + Intergenic
960133152 3:114078815-114078837 CATTTTGGATTTCAGATTTTCGG + Intronic
960196163 3:114770948-114770970 CATTTCAGATTTCAGATTTTCGG + Intronic
960651540 3:119956563-119956585 CATTTCAAATTTTGGATTTTTGG + Intronic
961108615 3:124264123-124264145 CATTTCGGAGTTTGGATTTTCGG - Intronic
961635890 3:128332423-128332445 CACTTTGGATTTTGGATTTCTGG - Intronic
961670976 3:128530026-128530048 CACTAAGGATTTTAGGTTTTTGG + Intergenic
961854723 3:129858360-129858382 AATTTCCCATTTTACATTTTTGG + Intronic
962566051 3:136661335-136661357 CACTTTGAATTTTGGATTTTTGG - Intronic
962745121 3:138391456-138391478 CCTTTCAGATTTCAGATTTTTGG - Intronic
963510643 3:146243517-146243539 CATTTCAGATTTTGGACTTTTGG - Intronic
963687661 3:148457724-148457746 CATTTCAGATTTCAAATTTTGGG + Intergenic
963957640 3:151272930-151272952 CACTTCGGACTTCAGATTTTGGG - Intronic
964089333 3:152855707-152855729 CATTTCAGATTTCAAATTTTTGG - Intergenic
964192900 3:154025657-154025679 CATTTCAGATTTTGGATTTTTGG - Intergenic
964227474 3:154423788-154423810 CACTTTTTATTTTATATTTTTGG - Intronic
964258557 3:154807520-154807542 CACTTCTGATTTTATTTATTTGG + Intergenic
964348846 3:155782932-155782954 CAGTTCAGATTTCAGATTTGTGG - Intronic
964438885 3:156683480-156683502 CACTTCCGATTTTCAGATTTGGG + Intronic
964516254 3:157511643-157511665 CATTTTGGATTTTAGATTTTTGG + Intronic
964727962 3:159834632-159834654 CATTTCAGATTTTAGATTTTGGG - Intronic
964799267 3:160535993-160536015 CACTTCATATTTCAGTTTTTAGG - Intronic
964804786 3:160596861-160596883 CATTTTGGATTTCAGATTTTTGG + Intergenic
964846448 3:161049383-161049405 CATTTTGGATTTTGGATTTTTGG + Intronic
964936909 3:162100748-162100770 CATTTCAGATTTAAGATTTTAGG - Intergenic
965155259 3:165043959-165043981 TATTTCAGATTTTGGATTTTTGG - Intronic
965438907 3:168688751-168688773 CATTTTCAATTTTAGATTTTTGG + Intergenic
965477483 3:169175266-169175288 CATTTCAGACTTTATATTTTTGG - Intronic
965874743 3:173302373-173302395 CATCTACTATTTTAGATTTTTGG - Intergenic
965914271 3:173822463-173822485 CATTTCAGATATTAGATTTTTGG - Intronic
966455300 3:180108275-180108297 TTCTTCCTATTTTAGGTTTTTGG + Intergenic
967283033 3:187840976-187840998 CACTTGCTATTTGAGATTATGGG + Intergenic
967342424 3:188414265-188414287 CATTTAAGATTTCAGATTTTTGG - Intronic
967377302 3:188819159-188819181 TAATTTCAATTTTAGATTTTGGG + Intronic
967386699 3:188919038-188919060 CATTTCAGATTTTGGATTTTTGG + Intergenic
967862536 3:194162813-194162835 CATTTCAGATTTGAAATTTTTGG + Intergenic
968033584 3:195525642-195525664 AACTTCCGAAATTAGATCTTTGG - Intronic
1202740925 3_GL000221v1_random:55051-55073 CATTTGGGATTTCAGATTTTTGG + Intergenic
968799778 4:2734213-2734235 CATTTTGGATTTCAGATTTTTGG - Intergenic
968865208 4:3205578-3205600 CATTTTGGATTTCAGATTTTTGG - Intronic
970197701 4:13568464-13568486 CACTTTAGATTTTTGAGTTTTGG + Intergenic
970564946 4:17322961-17322983 CATTTCAGATTTTGGATTCTCGG - Intergenic
970564958 4:17323070-17323092 CATTTCGGGTTTTGGATTTTTGG + Intergenic
970618700 4:17794453-17794475 CATTTCAGATTTCAAATTTTTGG + Intergenic
971017147 4:22499990-22500012 CATTTTGGATTTTAGATTTTTGG - Intronic
971019365 4:22518060-22518082 CATTTCAGGTTTTGGATTTTTGG - Intergenic
971030522 4:22632407-22632429 CAGTTTGGATTTCAGATTTTTGG + Intergenic
971387407 4:26153974-26153996 CATTTGAGATTTCAGATTTTTGG + Intergenic
971764028 4:30806078-30806100 CATTTCGGATTTCAGATTTTTGG + Intronic
971816315 4:31495332-31495354 CATTTCAGATTTTGAATTTTTGG + Intergenic
972277751 4:37572878-37572900 CATTTTGGATTTTGGATTTTTGG + Intronic
972488068 4:39561170-39561192 CATTTCAGATTTTGGATTTTAGG - Intronic
972653936 4:41048245-41048267 CATTTCAGATTTTGGAGTTTTGG + Intronic
972667192 4:41177874-41177896 CATTTCAGATTTCAGATTTTTGG - Intronic
972715482 4:41641802-41641824 CATTTCAGATTTCAGATTTTTGG + Intronic
972734766 4:41829870-41829892 CATTTCAGATTTCAGACTTTTGG - Intergenic
972772764 4:42213590-42213612 CACCTTTTATTTTAGATTTTAGG + Intergenic
972964491 4:44492780-44492802 CATTTCAGATTTCAGATTTTTGG - Intergenic
973263828 4:48190816-48190838 AACTTCTGATTTTATATTTAGGG - Intronic
973363380 4:49186171-49186193 CATTTGGGATTTCAGATTTTTGG - Intergenic
973397716 4:49610686-49610708 CATTTGGGATTTCAGATTTTTGG + Intergenic
973690646 4:53426515-53426537 CATTTCAGATTTCAGATTTTTGG + Intronic
973905518 4:55526032-55526054 CATTTCAGATTTCAGATTTTCGG + Intronic
974276588 4:59728383-59728405 CGCCTCTGATTTTAAATTTTTGG + Intergenic
975235079 4:71984884-71984906 CATTTCAAATTTTAGATTTTTGG + Intergenic
975659240 4:76671897-76671919 CACTGTGGATTTTGGATTTTTGG - Intronic
975834402 4:78406865-78406887 CATTTCAGATTTCAGATTTTTGG - Intronic
976310847 4:83611454-83611476 CACTTCTGATTTTATATATTTGG + Intergenic
976380798 4:84396021-84396043 CATTTCAGATTTCAGATTTTTGG + Intergenic
976418260 4:84804962-84804984 CATTTCAGATTTCAGATTTTTGG - Intronic
976456116 4:85248501-85248523 CGTTTCAGATTTTGGATTTTTGG + Intergenic
976650809 4:87432399-87432421 AATTTCTGATTTTGGATTTTTGG + Intronic
977006775 4:91576820-91576842 CATTTTGGATTTTAAATTTTTGG + Intronic
977241340 4:94574019-94574041 CATTTCAGATTTTGGATTCTTGG + Intronic
977299555 4:95252654-95252676 CATTTCAGATTCCAGATTTTTGG - Intronic
977444640 4:97115217-97115239 CATTTCAGATTTCAAATTTTTGG + Intergenic
977491519 4:97718919-97718941 TACTTTGGATTTCAGATTTTTGG - Intronic
977506949 4:97914738-97914760 CATTTCAGATTTTGGATTTTTGG - Intronic
977689021 4:99882302-99882324 CATTTCATATTTGAGATTTTTGG - Intronic
977690563 4:99904030-99904052 CATTTCGGATTTCAGAGTTTCGG - Intronic
977793827 4:101138564-101138586 TATTTAAGATTTTAGATTTTTGG - Intronic
978182255 4:105813313-105813335 CATTTTAGATTTTGGATTTTTGG - Intronic
978209238 4:106115192-106115214 CATTTCAGATTTTAGATTTTTGG - Intronic
978305660 4:107325369-107325391 CATTTCAGATTTCAGATTTTTGG - Intergenic
978487100 4:109267638-109267660 CTCTTCAGATTTCAGATTTTTGG - Intronic
978674851 4:111300329-111300351 TACTTCTGATTTTAGCTCTTTGG + Intergenic
978749912 4:112234336-112234358 CATTTCAGATTTTGGGTTTTGGG + Intronic
978877085 4:113654225-113654247 CTCTTCCAGTTTTAAATTTTAGG + Intronic
979065605 4:116128673-116128695 CCTTTCAGATTTTATATTTTTGG + Intergenic
979492244 4:121341504-121341526 CATTTCAGATTTCAGGTTTTGGG - Intronic
979585572 4:122411684-122411706 CATTTCATATTTCAGATTTTTGG + Intronic
979633291 4:122927813-122927835 CATTTCAGAGTTTAGATTCTTGG - Intronic
979932531 4:126648956-126648978 TATTTCTGATTTCAGATTTTTGG + Intergenic
980268757 4:130555941-130555963 CATCTCTGATTTTAGTTTTTGGG - Intergenic
980611176 4:135165968-135165990 TACTTTCTATTTTATATTTTAGG - Intergenic
981016930 4:139983657-139983679 CATTTCAGATTTCAGATTTTTGG + Intronic
981301803 4:143195307-143195329 CATTTCAGATTTCAAATTTTTGG + Intronic
981458443 4:144983421-144983443 CATTTCAGATTTTGGATTTTTGG + Intronic
981599612 4:146471149-146471171 CATTTTGGATTTTGGATTTTCGG - Intronic
982019379 4:151188488-151188510 CATTTCAGATTTCAGATTTTTGG - Intronic
982069209 4:151680797-151680819 CATTTCAGATTTCAGACTTTCGG - Intronic
982601813 4:157460906-157460928 AAATTCCGATTTTATATTTTTGG + Intergenic
982708905 4:158739933-158739955 CATTTCAGCTTTCAGATTTTTGG - Intergenic
983563738 4:169127959-169127981 CATTTCGGATTTCAGATTTTTGG - Intronic
983595268 4:169458979-169459001 CATTTCAGATTTTGGATTTACGG + Intronic
983865823 4:172765263-172765285 TACTTCTCATTTTATATTTTGGG - Intronic
984009405 4:174352718-174352740 CATTTCAGATTTCAGATCTTTGG - Intergenic
984153481 4:176164320-176164342 CATTTTGGATTTTGGATTTTTGG - Intronic
984605859 4:181785543-181785565 CATTTTGGATTTTGGATTTTCGG - Intergenic
984705817 4:182846367-182846389 GATTTCGGATTTTGGATTTTTGG - Intergenic
985118159 4:186612511-186612533 CATTTCGGATTTCAGATTTTTGG + Intronic
985185708 4:187313349-187313371 CACTTCTTATTTTGCATTTTTGG + Intergenic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
1202760739 4_GL000008v2_random:107696-107718 CATTTGGGATTTCAGATTTTTGG - Intergenic
986190089 5:5488467-5488489 CATTTTGGATTTCAGATTTTTGG + Intronic
986482070 5:8199473-8199495 CAATTTCCATTTTAAATTTTGGG + Intergenic
986819659 5:11451462-11451484 CATTTCAGATTTTGGATTTTTGG - Intronic
987114819 5:14717902-14717924 CATTTTGGATTTTCGATTTTTGG + Intronic
987665222 5:20929047-20929069 CACTTCTGATTTTATTTATTTGG + Intergenic
987921846 5:24293781-24293803 TACTTCATATTTAAGATTTTTGG + Intergenic
987982305 5:25101781-25101803 CACTTCTAATTCTAGGTTTTTGG + Intergenic
988141448 5:27246149-27246171 TACTTCAGATTTTGTATTTTTGG - Intergenic
988301366 5:29432193-29432215 TACTTAGGATTTTATATTTTTGG - Intergenic
988312092 5:29572740-29572762 CATTTTGAATTTTAGATTTTTGG + Intergenic
988545268 5:32150716-32150738 CATTTTGGATTTCAGATTTTCGG - Intronic
988757467 5:34273136-34273158 CACTTCTGATTTTATTTATTTGG - Intergenic
989014540 5:36914396-36914418 CATTTTGGATTTCAGATTTTTGG - Intronic
989021148 5:37010884-37010906 CATTTCCGATTTTAGATTTTTGG - Intronic
989050853 5:37318569-37318591 CAATTTCGATTTCAAATTTTCGG + Intronic
989078695 5:37592630-37592652 CACTTTGGATTTTGGATATTTGG + Intronic
989821952 5:45803140-45803162 CTGTTCAGATTTTAAATTTTAGG + Intergenic
990110988 5:52324474-52324496 AATTTTGGATTTTAGATTTTTGG - Intergenic
990212984 5:53500443-53500465 CACCTCCCAATTTAGAATTTAGG - Intergenic
990455661 5:55984718-55984740 CATTTTGGATTTCAGATTTTAGG + Intronic
990565791 5:57027287-57027309 CATTTTGGATTTCAGATTTTTGG - Intergenic
991087827 5:62664504-62664526 CATTTCAGATTTCAGATTTTAGG + Intergenic
991126249 5:63072898-63072920 CACTTCAGATTTCAGATTTTTGG + Intergenic
991664579 5:68985789-68985811 CATTTCAGAATTTGGATTTTTGG + Intergenic
992060515 5:73040363-73040385 CACTTTGGATTTCAGATTTTTGG + Intronic
992246649 5:74831580-74831602 CATTTCAGATTTTGGATGTTTGG - Intronic
992264223 5:75002381-75002403 CATTTCCGGTTTCGGATTTTTGG - Intergenic
992417679 5:76567314-76567336 CATTTCGGATTTCGGATTTTGGG + Intronic
992817633 5:80461069-80461091 CATTTCAGATTTCAGATTTTTGG - Intronic
993199023 5:84788855-84788877 CAATACTGATTTTGGATTTTTGG - Intergenic
993310193 5:86320313-86320335 CATTTATGATTTTGGATTTTTGG - Intergenic
993325097 5:86524347-86524369 CACTTCCTACTTTACATTATGGG - Intergenic
993568473 5:89505583-89505605 CACATAGGAGTTTAGATTTTTGG - Intergenic
993876492 5:93313530-93313552 CATTTTAGATTTTAGATTTTTGG - Intergenic
993928000 5:93896256-93896278 CATTACGGATTTCAGATTTTTGG - Intronic
993990864 5:94656832-94656854 CACTTCTGATTTTATTTATTTGG + Intronic
994087433 5:95775311-95775333 CATTTTGGATTTTGGATTTTTGG + Intronic
994766744 5:103928045-103928067 CCCTTCCAATTTTAGAGTTTAGG - Intergenic
994828447 5:104746424-104746446 CACTTCCGAATTTAGCTTTGGGG - Intergenic
994934234 5:106233057-106233079 CATTTCAGATTTTGGATTTTTGG + Intergenic
995499497 5:112789259-112789281 CACTTCACAATTTGGATTTTTGG - Intronic
995729783 5:115226199-115226221 CATTTCAGATTTTAGAATTTTGG - Intronic
996093490 5:119374252-119374274 CATTTCAGATTTCAAATTTTTGG - Intronic
996430234 5:123367443-123367465 CACTTTGGATTTTGGATTTTTGG - Intronic
996555783 5:124777712-124777734 CACTTCAGCATTTAGAATTTGGG + Intergenic
996703855 5:126477093-126477115 CATTTCAGATTTTGGATTTTTGG - Intronic
997138703 5:131354784-131354806 CATTTCAGATTTCAGATTTTTGG - Intronic
997921779 5:137986925-137986947 CACTTCAGATTTTGGATTTTTGG + Intronic
998042232 5:138958573-138958595 CATTTTGGATTTTAGATTTTTGG - Intronic
998042240 5:138958656-138958678 CACTTTGGATTTTGGATTTTTGG + Intronic
998225582 5:140323792-140323814 CACCTCCTTTTCTAGATTTTTGG - Intergenic
998585077 5:143419007-143419029 CATTTCCGATTTCAGAATTTGGG - Intronic
998585084 5:143419090-143419112 CATTTCAGATTTTGGATTTTTGG + Intronic
998865402 5:146495268-146495290 CAATTCAGATTTTTGAATTTGGG - Intronic
999921882 5:156330095-156330117 CATTTCAGAGTTCAGATTTTTGG - Intronic
999952677 5:156667005-156667027 CATTTTGGATTTTGGATTTTTGG - Intronic
1000217653 5:159178627-159178649 CATTTTGGATTTTAGATTTTTGG - Intronic
1000368563 5:160513105-160513127 CATTTCAGATTTTAGATTTTTGG - Intergenic
1000466455 5:161583942-161583964 CACTTGCGATCTTAGCTATTTGG + Intronic
1000560447 5:162780943-162780965 CATTTTGAATTTTAGATTTTGGG + Intergenic
1000906760 5:166973628-166973650 CATTTCAGATTTCAAATTTTTGG + Intergenic
1001098237 5:168792804-168792826 CATTTCAGATTTTGGATTTTTGG - Intronic
1001350763 5:170961522-170961544 CATTTCAAATTTCAGATTTTTGG - Intronic
1001350767 5:170961618-170961640 CATTTCAGATTATGGATTTTTGG + Intronic
1001468910 5:171994387-171994409 CACTTTGGATTTTGTATTTTTGG - Intronic
1001473171 5:172030275-172030297 CAATTCAGATTTTGGATTTTTGG + Intergenic
1002836715 6:870890-870912 CATTTTGGATTTCAGATTTTTGG - Intergenic
1002946726 6:1768587-1768609 CATTTCAGATTTCAGATTTTTGG - Intronic
1003020736 6:2506901-2506923 CATTTTGGCTTTTAGATTTTGGG + Intergenic
1003362218 6:5438832-5438854 CATTTTGGATTTTGGATTTTTGG + Intronic
1004215420 6:13699537-13699559 CATTTTAGATTTTGGATTTTTGG - Intronic
1004488834 6:16094333-16094355 CATTTTGGATTTCAGATTTTTGG - Intergenic
1004717932 6:18236824-18236846 CATTTCAGGTTTTGGATTTTTGG - Intronic
1004758947 6:18644573-18644595 CATTTTAGATTTCAGATTTTTGG - Intergenic
1004954202 6:20709334-20709356 CATTTCAGATTTTGGATTTTTGG - Intronic
1004974066 6:20945198-20945220 CATTTTGGATTTTGGATTTTTGG - Intronic
1005443916 6:25901460-25901482 TATTTCAGATTTTGGATTTTTGG - Intergenic
1006318146 6:33303009-33303031 CATTTCAGATTTTAGAGTTTTGG - Intronic
1006526537 6:34610574-34610596 CATTTCAGATTTTGAATTTTTGG + Intronic
1006687602 6:35849717-35849739 CATTTCAAAGTTTAGATTTTTGG + Intronic
1006763985 6:36488673-36488695 CACTTCAAATTTCGGATTTTTGG + Exonic
1007019087 6:38501298-38501320 CATTTCAGATTTCAGGTTTTCGG + Intronic
1008142352 6:47846522-47846544 CATTTCAGATTTTGAATTTTTGG + Intergenic
1008955397 6:57210907-57210929 CATTTCAGACTTCAGATTTTTGG - Intronic
1009004614 6:57768075-57768097 TACTTGGGATTTTATATTTTTGG - Intergenic
1009318751 6:62257976-62257998 CATTTCAGATTTTGGATTTTTGG - Intronic
1009636580 6:66273065-66273087 CATTTCAGATTTGAGATTTTTGG + Intergenic
1010243046 6:73634720-73634742 CATTTCAGAGTTCAGATTTTTGG - Intronic
1010260464 6:73809568-73809590 CATTTTGGATTTCAGATTTTTGG - Intronic
1010496214 6:76536417-76536439 CATTTCCGATTTTATTTATTTGG + Intergenic
1011018062 6:82781043-82781065 CATTTCAGATTTTGGACTTTTGG + Intergenic
1011064865 6:83314269-83314291 CATTTTGGATTTTGGATTTTTGG - Intronic
1011737390 6:90325609-90325631 CATTCCAGATTTTGGATTTTTGG + Intergenic
1011793757 6:90929785-90929807 AGCTTCCGATTTTGGATTTCTGG - Intergenic
1011994053 6:93562819-93562841 CACTTCTGAGATTAGGTTTTAGG + Intergenic
1012442257 6:99271478-99271500 CGTTTCAGATTTTGGATTTTTGG - Exonic
1012727129 6:102828253-102828275 CATTTCAGATTTTGGATTTTTGG - Intergenic
1013228235 6:108136793-108136815 CATTTCAGATTTAAGGTTTTTGG - Intronic
1014189761 6:118481446-118481468 CATTTCAGATTTCAGGTTTTTGG - Intronic
1014247112 6:119080677-119080699 CATTTTGGATTTCAGATTTTTGG - Intronic
1014273759 6:119364074-119364096 CATTTCGGATTTTAGATTTTTGG + Intergenic
1015113585 6:129620338-129620360 CATTTAGGATTTTGGATTTTTGG + Intronic
1015573631 6:134647810-134647832 CAGTTCAGATTTTTGCTTTTAGG - Intergenic
1015608370 6:134985573-134985595 CATTTCAGATTTCAGAATTTTGG - Intronic
1016937737 6:149460245-149460267 CATTTCAGATTTGGGATTTTTGG + Intronic
1017681008 6:156863680-156863702 CACTTCCTATTTCATACTTTTGG - Intronic
1018163036 6:161066035-161066057 CATTTCAGATTTTGGGTTTTTGG + Intronic
1018331362 6:162731159-162731181 CACTTCAGGTTTCAGACTTTTGG - Intronic
1018829457 6:167432080-167432102 CATGTCAGATTTTAGACTTTTGG + Intergenic
1018840806 6:167514936-167514958 CATTTCTGATTTCAGATTTACGG + Intergenic
1018874920 6:167813420-167813442 CATTTTGGATTTCAGATTTTTGG + Intergenic
1019102577 6:169642959-169642981 CATCTCAGATTTCAGATTTTTGG - Intronic
1020346142 7:7165736-7165758 CATTTCAGATTTTGGGTTTTTGG - Intronic
1020396102 7:7720378-7720400 CACTTCTGATTTTATAGGTTTGG + Intronic
1020666011 7:11044993-11045015 CACTTCAGATTTTGGATTTTTGG + Intronic
1020935254 7:14455999-14456021 CATTTCGGATTTTGGATTTTTGG - Intronic
1021144524 7:17068554-17068576 CATTTCAGATTCCAGATTTTTGG - Intergenic
1021144532 7:17068637-17068659 CATTTCAGATTTCGGATTTTTGG + Intergenic
1021304727 7:19018841-19018863 CATTTCTGATTTTAGTTATTTGG - Intergenic
1021321874 7:19222640-19222662 CAATTTTAATTTTAGATTTTGGG + Intergenic
1021329509 7:19318309-19318331 CATCTCAGATTTCAGATTTTTGG - Intergenic
1021811899 7:24410513-24410535 CATTTCAGATTTTGGATTTTTGG - Intergenic
1021832793 7:24633644-24633666 CATTTTGGATTTTAGATTTTTGG + Intronic
1022087735 7:27085405-27085427 TATTTCAGATTTTGGATTTTTGG + Intergenic
1022150042 7:27593162-27593184 CATTTCGGATTTCAGATTTTTGG - Intronic
1022150346 7:27596787-27596809 CATTTCAGATTTTGGATTTTTGG - Intronic
1022266272 7:28757920-28757942 CATTTTGGATTTTGGATTTTTGG + Intronic
1022690353 7:32644933-32644955 CATTTCAGATTTTGGTTTTTTGG - Intergenic
1022762672 7:33373510-33373532 CATTTTGGATTTTGGATTTTTGG + Intronic
1022917896 7:34978797-34978819 CATTTCAGATTTTGGTTTTTTGG - Intronic
1022941097 7:35240208-35240230 CATTTCAGATTTTAGATTTGTGG - Intronic
1023028876 7:36076034-36076056 CACTTTGGATTTTGGATTTTTGG - Intergenic
1023061078 7:36327666-36327688 CATTTCAGATTTTGCATTTTTGG - Intronic
1023168719 7:37369339-37369361 CATTTCAGATTTCAGATTTTTGG - Intronic
1023387693 7:39676586-39676608 CATTTCACATTTTGGATTTTTGG + Intronic
1023407519 7:39850299-39850321 CATTTCTGATTTTGGAATTTTGG - Intergenic
1023724689 7:43130824-43130846 TATTTCAGATTTCAGATTTTTGG + Intronic
1023958590 7:44908044-44908066 CATTTCCGATTTTGGATTTTTGG + Intergenic
1024311047 7:47969513-47969535 GACTTCCCCTTTGAGATTTTTGG - Intronic
1024320069 7:48056612-48056634 CATTTCGGATTTTGGATTTTTGG + Intronic
1024558504 7:50623959-50623981 CATTTCAGATTTCAGATTTTTGG + Intronic
1024902952 7:54343084-54343106 CAATTCAGATTTTGGATTTTTGG + Intergenic
1025830740 7:65047012-65047034 CATTTCAGATTTTGGATTTTTGG - Intergenic
1025842575 7:65164360-65164382 CATTTTGGATTTCAGATTTTTGG + Intergenic
1025880470 7:65531608-65531630 CATTTTGGATTTCAGATTTTTGG - Intergenic
1025892967 7:65670996-65671018 CATTTTGGATTTCAGATTTTTGG + Intergenic
1025917905 7:65880928-65880950 CATTTCAGATTTTGGATTTTCGG - Intronic
1026030952 7:66793472-66793494 CATTTCAGATTTTTTATTTTTGG + Intronic
1026376755 7:69759498-69759520 CATTTCAGACTTCAGATTTTCGG + Intronic
1026633837 7:72063693-72063715 CATTTCTGATTTCAGATTTTAGG - Intronic
1026633846 7:72063776-72063798 CATTTCAGATTTTGGATTTTGGG + Intronic
1027289671 7:76692115-76692137 CACTTTGGATTTCAGATTTTTGG - Intergenic
1027784012 7:82556449-82556471 TAGTTCTGTTTTTAGATTTTTGG - Intergenic
1028229860 7:88294134-88294156 CATTTCTGATTTTATATTTTTGG - Intronic
1028757237 7:94451712-94451734 TCCTTCCGATTTTTGATTTGGGG + Intergenic
1029727988 7:102420723-102420745 CATTTCCGAGTTTGGATTTTTGG - Intronic
1029989915 7:104953548-104953570 CACTTGCTAATTTTGATTTTGGG + Intergenic
1030433256 7:109480498-109480520 CATTTCTGATTTTAAATTCTGGG + Intergenic
1030545183 7:110885315-110885337 CATTTCAGATTTCAGACTTTTGG + Intronic
1030801203 7:113855016-113855038 CATTTCAGATTTCAGATTTTTGG - Intergenic
1031067237 7:117118201-117118223 CATTTTGGATTTTGGATTTTTGG + Intronic
1031405166 7:121376573-121376595 CATTTTAGATTTCAGATTTTCGG - Intronic
1031631104 7:124044031-124044053 CACTTCAGCTTTCAGATATTTGG + Intergenic
1031860461 7:126973950-126973972 CATTTTGGATTTTAGATCTTTGG - Intronic
1031928434 7:127660670-127660692 CATTTCAGATTTTGGATTTTTGG + Intronic
1032098898 7:128956575-128956597 CATTTTGGATTTTGGATTTTTGG + Intronic
1032175295 7:129619025-129619047 CATTTCAGATTTTAAACTTTTGG + Intronic
1032635624 7:133704871-133704893 CATTTCAGATTTCAGACTTTTGG + Intronic
1032829264 7:135606440-135606462 CATTTTGGATTTTGGATTTTTGG + Intronic
1033036601 7:137881292-137881314 CATTTTAGATTTTAGATTTTCGG - Intronic
1033261985 7:139851926-139851948 CACTTCCAAGATTAGATTATTGG + Intronic
1033418880 7:141188345-141188367 CATTTCAGGTTTTGGATTTTTGG + Intronic
1033594741 7:142850118-142850140 CACTTCCGACTTCTGATCTTTGG + Intergenic
1034024138 7:147679851-147679873 CAATCCTGATTTTAGATTTGGGG - Intronic
1036112688 8:5921609-5921631 TCCTTCCAATTTTAGATGTTAGG + Intergenic
1036441573 8:8786376-8786398 CAGTTCCGTGTTTAGAGTTTTGG - Intronic
1036468457 8:9026192-9026214 CATTTCAGATTTTGGGTTTTTGG + Intronic
1036718087 8:11145171-11145193 CATTTTGGATTTCAGATTTTTGG + Intronic
1037275178 8:17170924-17170946 CACTTCCAATTCTAAAATTTTGG + Intronic
1037441943 8:18925525-18925547 CATTTTGAATTTTAGATTTTTGG - Intronic
1037580731 8:20244711-20244733 CACTTCCGCTTTTATACTCTCGG - Intergenic
1037849568 8:22315833-22315855 CATTTTGGATTTTAGATTTCTGG + Intronic
1038200162 8:25404565-25404587 CATTTTGGATTTTGGATTTTGGG + Intronic
1038350102 8:26768491-26768513 CATTTCGGATTTCAGATTTTCGG - Intronic
1038739550 8:30205030-30205052 CATTTTGGATTTCAGATTTTTGG - Intergenic
1038812447 8:30863279-30863301 CATTTCAGATTTCAAATTTTTGG + Intronic
1039055244 8:33531151-33531173 CAATTCAGATTTAAGATTTCAGG + Intergenic
1040045912 8:42963276-42963298 CATTTCAGCTTTTGGATTTTTGG - Intronic
1040045918 8:42963360-42963382 CATTTCTGAGTTTGGATTTTTGG + Intronic
1040615940 8:49038527-49038549 AAGTTCCTATTTTATATTTTTGG - Intergenic
1040821637 8:51565089-51565111 CATTTCAGATTTCACATTTTTGG - Intronic
1040971848 8:53143666-53143688 CATTTCAAATTTTAGATTTTGGG - Intergenic
1041353705 8:56976890-56976912 CATTTCAGATTTTGGAATTTTGG - Intronic
1041512326 8:58665609-58665631 CATTTTGGATTTCAGATTTTTGG + Intergenic
1041924324 8:63220992-63221014 CCCTTCAGATTTTGGGTTTTTGG + Intergenic
1042477892 8:69269713-69269735 CATTTCAGATTTCAGATTTTCGG + Intergenic
1042496576 8:69461322-69461344 TACTTCAGATTTGGGATTTTGGG - Intergenic
1042675338 8:71314658-71314680 CATTTTGGATTTCAGATTTTTGG + Intronic
1042901747 8:73735545-73735567 CATTTTGGATTTTCGATTTTTGG + Intronic
1042974220 8:74447425-74447447 CACTTCAGATTTCAGTTTTCCGG - Intronic
1043104661 8:76092286-76092308 CATTTTGGATTTTAAATTTTTGG - Intergenic
1043269875 8:78319047-78319069 CATTTCAGATTTTGGATTTTTGG - Intergenic
1043850958 8:85216038-85216060 CACTTCCAATACTAGATTTGTGG - Intronic
1043959784 8:86404134-86404156 CATTTCAGATTTTGAATTTTTGG + Intronic
1043993323 8:86782265-86782287 CATTTCAGATTTTGGATTTTTGG + Intergenic
1044192467 8:89335026-89335048 CACTGCCCATATTAGACTTTGGG + Intergenic
1044571977 8:93730002-93730024 CATTTAAGATTTCAGATTTTTGG - Exonic
1044894230 8:96872372-96872394 CATTTGGGATTTTGGATTTTTGG + Intronic
1045093748 8:98775200-98775222 CATTTTGGATTTCAGATTTTTGG - Intronic
1045580560 8:103475094-103475116 CATTTTGGATTTTGGATTTTTGG - Intergenic
1045668681 8:104521185-104521207 CACTTCAGATTTTTGGTTTTGGG - Intronic
1045717781 8:105068520-105068542 CATTTCAGATTTCAGATTATTGG + Intronic
1045902716 8:107303225-107303247 CACTTCTGGTTTTACCTTTTTGG + Exonic
1045922771 8:107551005-107551027 TATTTCAGATTTTAGGTTTTTGG - Intergenic
1046271870 8:111906298-111906320 CATTTTGGATTTTGGATTTTTGG + Intergenic
1046342148 8:112873294-112873316 AACATCCAATTTTAAATTTTGGG - Intronic
1046801177 8:118429334-118429356 TACTTCAGATTTTAAATTTTTGG + Intronic
1046852428 8:118989971-118989993 CATTTCAAATTTTGGATTTTGGG + Intergenic
1047175713 8:122538435-122538457 CCCTTCTGGTTTTAGATTTCAGG - Intergenic
1047241099 8:123089144-123089166 CATTTAAGATTTCAGATTTTCGG + Intronic
1047294625 8:123560052-123560074 CATTTCAGATTTTGGATTTTTGG + Intergenic
1047438400 8:124855084-124855106 CATTTCAGATTTCCGATTTTCGG + Intergenic
1048155358 8:131943041-131943063 CATTTCAGATTTCAGGTTTTTGG - Intronic
1048471847 8:134711364-134711386 CATTTCCGATTTCGGATTTTTGG + Intronic
1050217532 9:3344458-3344480 TATTTCGGATTTCAGATTTTCGG + Intronic
1050453875 9:5813559-5813581 CATTTCTGATTTTGGATTTTAGG - Intronic
1050727440 9:8667447-8667469 CATTTTGGATTTCAGATTTTTGG - Intronic
1052321050 9:27167985-27168007 CATCTCAGATTTCAGATTTTTGG - Intronic
1053192981 9:36089505-36089527 CATTTTGGATTTCAGATTTTTGG - Intronic
1053226227 9:36360509-36360531 CATTTTGGATTTCAGATTTTGGG - Intronic
1053255177 9:36611026-36611048 CATTTCAGGTTTTGGATTTTCGG + Intronic
1053264705 9:36702515-36702537 CATTTCAGATTTCAGATTTTTGG + Intergenic
1054824643 9:69560753-69560775 CATTTTAGATTTTGGATTTTTGG - Intronic
1054825013 9:69565161-69565183 CACTTCACATTTTAGATGTTTGG - Intronic
1055048596 9:71956668-71956690 CATTTCAGATTTCAGATTTTTGG + Intronic
1055761698 9:79616025-79616047 CACTTCACTTTTTAGCTTTTAGG + Intronic
1055876607 9:80950695-80950717 CATTTTTGATTTTTGATTTTTGG - Intergenic
1056143071 9:83703256-83703278 CATTTCAGATTTCATATTTTTGG - Intronic
1056337015 9:85581896-85581918 CATTTTGGATTTCAGATTTTGGG + Intronic
1056405626 9:86271528-86271550 CATTTCAGATTTCAGATTTTTGG + Intronic
1056457285 9:86772603-86772625 CAATTTCTATTTTATATTTTTGG + Intergenic
1057045487 9:91883081-91883103 TACTTCAGATTTCGGATTTTTGG + Intronic
1057342244 9:94213302-94213324 CATTTCAGATTTTGGATATTGGG + Intergenic
1057755889 9:97835081-97835103 TGCTTCAGATTTTGGATTTTGGG + Intergenic
1058852720 9:109028143-109028165 CATTTTGGATTTTAGATTCTTGG - Intronic
1058852867 9:109029613-109029635 CACATCCTCTTATAGATTTTCGG - Intronic
1059303698 9:113337373-113337395 CATTTTGGATTTTGGATTTTTGG - Intronic
1059380945 9:113923888-113923910 CATTTCAAATTTTGGATTTTTGG - Intronic
1059380951 9:113923971-113923993 CACTTTGGATTTAAGATGTTTGG + Intronic
1059519929 9:114931600-114931622 CACTTCAGGTTTTAGCTTTCAGG - Intergenic
1059740400 9:117144319-117144341 CATTTCGGATTTCAGATTTTCGG - Intronic
1060710348 9:125857376-125857398 CATTTCGAATTTCAGATTTTTGG + Intronic
1061651808 9:132056539-132056561 CATTTTGGATTTCAGATTTTTGG + Intronic
1062257819 9:135637554-135637576 GTTTTCAGATTTTAGATTTTTGG + Intronic
1203750868 Un_GL000218v1:78875-78897 CATTTGGGATTTCAGATTTTTGG + Intergenic
1203483122 Un_GL000224v1:25469-25491 CATTTGGGATTTCAGATTTTTGG - Intergenic
1203709563 Un_KI270742v1:84981-85003 CATTTGGGATTTCAGATTTTTGG + Intergenic
1203541510 Un_KI270743v1:92582-92604 CATTTGGGATTTCAGATTTTTGG - Intergenic
1185568690 X:1115884-1115906 CTCTTCCTACTTTAGATTCTTGG - Intergenic
1186224718 X:7386445-7386467 CTCTTCCGATCTTATATTTTGGG + Intergenic
1186412772 X:9358429-9358451 CATCTCAGATTTTGGATTTTTGG - Intergenic
1186505094 X:10085203-10085225 CATTTCAGGTTTCAGATTTTTGG - Intronic
1187195440 X:17079163-17079185 CATTTTGGATTTTGGATTTTTGG + Intronic
1187301636 X:18056727-18056749 CATTTCCCTTTTTTGATTTTTGG + Intergenic
1187595719 X:20770624-20770646 CATTTTGGATTTCAGATTTTTGG + Intergenic
1187782587 X:22844520-22844542 CATTTTGGATTTTGGATTTTTGG - Intergenic
1187813668 X:23208062-23208084 CAGTTCAAATTTTATATTTTTGG + Intergenic
1187919105 X:24183526-24183548 CATTTCAGATATTGGATTTTTGG - Intronic
1187991136 X:24874153-24874175 CTCTTCCAATTTTAAAATTTAGG + Intronic
1188001374 X:24985703-24985725 CATTTCAGAGTTCAGATTTTCGG + Intronic
1188018635 X:25133288-25133310 CATTTTGGATGTTAGATTTTTGG - Intergenic
1188018642 X:25133368-25133390 CATTTCAGATTTCAGATTTTTGG + Intergenic
1188228750 X:27634617-27634639 CATTTCAGGTTTCAGATTTTTGG - Intronic
1188420941 X:29990217-29990239 CACTTCTGATTTTATTTGTTTGG + Intergenic
1188522871 X:31058236-31058258 CATTTCAGATTTCAGATTTTTGG - Intergenic
1188812723 X:34671706-34671728 CATTTCAGATTTTGTATTTTTGG + Intergenic
1189576416 X:42358670-42358692 CATTTCAGATTTTGGATATTTGG + Intergenic
1189749940 X:44210689-44210711 CATTTCAGATTTTATATTTAGGG - Intronic
1189841908 X:45088697-45088719 CACTTCAAATTTCATATTTTGGG - Intronic
1189929564 X:45994520-45994542 CATTTCTGATTTTATATATTTGG + Intergenic
1190022675 X:46893513-46893535 CATTTTGGATTTCAGATTTTTGG - Intronic
1190022681 X:46893588-46893610 CATTTTAGATTTCAGATTTTTGG + Intronic
1190117970 X:47638138-47638160 CTCTTCCGATTTCAGGTTTGGGG + Exonic
1190141398 X:47848655-47848677 CATTTTGGATTTTGGATTTTTGG - Intronic
1190434695 X:50412035-50412057 CATTTCAGATGTCAGATTTTTGG - Intronic
1190906203 X:54730837-54730859 AACTTCCGAGGTGAGATTTTGGG + Intergenic
1190961796 X:55257524-55257546 CTCTTACAATTTTAAATTTTAGG - Intronic
1190972577 X:55365915-55365937 CATTTTGGATTTCAGATTTTTGG + Intergenic
1191205473 X:57828715-57828737 CATTTCAGATTTAAGATATTTGG - Intergenic
1191810773 X:65185946-65185968 CACTTGCTAATATAGATTTTGGG - Intergenic
1192530420 X:71878044-71878066 CACCTCTGATTTTATATATTTGG - Intergenic
1192591653 X:72365153-72365175 CATTTCAGATTTCGGATTTTGGG - Intronic
1193343113 X:80374942-80374964 CATTTCAGATTTCAGATTTTTGG + Intronic
1193482226 X:82042586-82042608 CACTGCAGATTTGAGCTTTTGGG + Intergenic
1193853433 X:86568911-86568933 CACTTCCGATTTCACCTTCTGGG + Intronic
1195158965 X:102153081-102153103 CATTTCAGATTTCAGATTTCTGG - Intergenic
1195230970 X:102846673-102846695 TACTTCCAATTTTATATTTGTGG + Intergenic
1195574224 X:106431653-106431675 CACTTCCCATTTTTGATTCCAGG - Intergenic
1195591834 X:106638226-106638248 CATTTCAGATTTCGGATTTTTGG - Intronic
1195623473 X:106983053-106983075 CATTTTGGATTTTGGATTTTTGG - Intronic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1195699076 X:107688843-107688865 CATTTCAGATTTCAGATTTTTGG - Intergenic
1195699081 X:107688919-107688941 CATTTCAGATTTAAGATTTTTGG + Intergenic
1195767323 X:108309868-108309890 CATTTTGGATTTTGGATTTTTGG - Intronic
1195869010 X:109466234-109466256 TATTTCAGATTTCAGATTTTTGG - Intronic
1195964366 X:110416952-110416974 TACTTCCAATTTTCGGTTTTTGG + Intronic
1196291025 X:113941331-113941353 CATTTCAGATTTCAGATATTTGG + Intergenic
1196318566 X:114260387-114260409 CATTTCAGATTTTGGATTTGGGG + Intergenic
1196358652 X:114826043-114826065 TATTTCAGATTTCAGATTTTGGG - Intronic
1196694268 X:118594438-118594460 CATTTCATATTTTGGATTTTTGG + Intronic
1197429216 X:126340066-126340088 AATTTCCCATTTTATATTTTTGG - Intergenic
1197494260 X:127157898-127157920 CATTTTGGATTTCAGATTTTTGG - Intergenic
1197660319 X:129163592-129163614 CATTTCAAATTTTACATTTTTGG + Intergenic
1199013135 X:142780248-142780270 CACTTCCCATTTCTCATTTTAGG - Intergenic
1199490325 X:148391090-148391112 CATTTCAGATTTTATTTTTTTGG - Intergenic
1199635232 X:149807055-149807077 CACTTCTGTTTCTAGATCTTAGG + Intergenic
1201164522 Y:11196503-11196525 CATTTCGGATTTCAGATTTTTGG + Intergenic