ID: 1195626753

View in Genome Browser
Species Human (GRCh38)
Location X:107011461-107011483
Sequence CACATTGTGCACGTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195626751_1195626753 13 Left 1195626751 X:107011425-107011447 CCAACATGGCACATGTATACATA 0: 10076
1: 16018
2: 8885
3: 6827
4: 5856
Right 1195626753 X:107011461-107011483 CACATTGTGCACGTGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195626753 Original CRISPR CACATTGTGCACGTGTACCC TGG Intergenic
No off target data available for this crispr