ID: 1195626794

View in Genome Browser
Species Human (GRCh38)
Location X:107012179-107012201
Sequence AGAAGTAGCTTGCACATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195626791_1195626794 26 Left 1195626791 X:107012130-107012152 CCTGGATTCACTATATCACAGAA No data
Right 1195626794 X:107012179-107012201 AGAAGTAGCTTGCACATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195626794 Original CRISPR AGAAGTAGCTTGCACATTGG TGG Intergenic
No off target data available for this crispr