ID: 1195630335

View in Genome Browser
Species Human (GRCh38)
Location X:107049201-107049223
Sequence AGATTGCAAGAGATTTATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195630333_1195630335 3 Left 1195630333 X:107049175-107049197 CCAGACTTTGTCTCCTATAAATC No data
Right 1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG No data
1195630334_1195630335 -10 Left 1195630334 X:107049188-107049210 CCTATAAATCATGAGATTGCAAG No data
Right 1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG No data
1195630332_1195630335 4 Left 1195630332 X:107049174-107049196 CCCAGACTTTGTCTCCTATAAAT No data
Right 1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG No data
1195630331_1195630335 30 Left 1195630331 X:107049148-107049170 CCTTTTGGGAGACAATCTTTTCT No data
Right 1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195630335 Original CRISPR AGATTGCAAGAGATTTATCT CGG Intergenic
No off target data available for this crispr