ID: 1195633196

View in Genome Browser
Species Human (GRCh38)
Location X:107082053-107082075
Sequence GTCAAAAAGAAGTGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 584}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195633190_1195633196 20 Left 1195633190 X:107082010-107082032 CCTTCACTTGTTTTATTGCTGTA 0: 1
1: 0
2: 2
3: 54
4: 393
Right 1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG 0: 1
1: 0
2: 4
3: 60
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195633196 Original CRISPR GTCAAAAAGAAGTGGGGAAA GGG Intronic
902099007 1:13969659-13969681 GCCACAAAGAGTTGGGGAAAGGG - Intergenic
902640502 1:17763492-17763514 GTCCCGCAGAAGTGGGGAAAAGG - Intronic
903353146 1:22730312-22730334 GCCCACAAGAAGTGGGGGAAGGG - Intronic
903402573 1:23066552-23066574 GTCAAACACAAGTGTGCAAATGG - Intronic
905608654 1:39328366-39328388 GTTAAAAAAGAGGGGGGAAAAGG + Intronic
906768810 1:48463634-48463656 GCCAAAAAGAAGAAGGAAAAAGG + Intronic
906977429 1:50590668-50590690 GTCAAATAGAAATGGTGAAAGGG + Intronic
908485542 1:64588797-64588819 TTTAAAAAGAAGGGGGCAAAGGG + Intronic
908556472 1:65261697-65261719 GTAGAAAAGAAGTGGGAGAAGGG - Intronic
908876051 1:68677145-68677167 GTTGAATAGAAGTGGTGAAAGGG + Intergenic
910756643 1:90700405-90700427 GCCAAAGAAAAGTAGGGAAAGGG + Intergenic
910773656 1:90853440-90853462 GTCAGAAAGCAATGGGGATAGGG + Intergenic
910830236 1:91453780-91453802 GTCATAAAGAACTGGGGGGAGGG + Intergenic
911276571 1:95867210-95867232 ATCAAAAAGAATTATGGAAAAGG + Intergenic
911578637 1:99608706-99608728 GACAAAAACAAGCGGGGGAAAGG - Intergenic
912478795 1:109961792-109961814 GGCAAACAGATGGGGGGAAATGG + Intergenic
913044737 1:115064235-115064257 GTCAAATAGAAGTGTGGGATGGG - Intronic
913445174 1:118943518-118943540 GTCTAAAAGAAGAGAGAAAAGGG + Intronic
913722140 1:121607524-121607546 GTCATGAAGAAGTAAGGAAAAGG - Intergenic
913741925 1:121855104-121855126 GTCATGAAGAAGTAAGGAAAAGG - Intergenic
914431212 1:147621271-147621293 GTTAAAAGGAAGAGGGGAAATGG + Intronic
914478855 1:148047330-148047352 GTCTAAAAAAAGCGGGGGAAGGG + Intergenic
914756122 1:150562430-150562452 CTCTAAAATAAGAGGGGAAAGGG - Intergenic
915173269 1:153993571-153993593 AAAAAAAAAAAGTGGGGAAATGG + Intronic
915356583 1:155258676-155258698 GACAATAAAAAGTGGGGAGAGGG + Intronic
915667591 1:157459026-157459048 GACAAAGAAATGTGGGGAAAGGG - Intergenic
915808384 1:158879001-158879023 GTCAAAAGGTAATTGGGAAAAGG + Intergenic
916486032 1:165259472-165259494 ACCAAAATGATGTGGGGAAATGG - Intronic
916986217 1:170194089-170194111 ATTGAATAGAAGTGGGGAAAGGG + Intergenic
917003122 1:170383371-170383393 GTTAAAAAGCAGGGGGAAAAAGG - Intergenic
917273013 1:173299208-173299230 TCCTAAAAGCAGTGGGGAAAAGG - Intergenic
917910409 1:179638718-179638740 GGGAAAAAGAAGTGGGGGATGGG + Intronic
917942508 1:179936354-179936376 GTCAAAATGCTATGGGGAAATGG + Intergenic
917960322 1:180138487-180138509 GTCCAAAAGAAGGCAGGAAAGGG + Intergenic
918257984 1:182767398-182767420 GGCAAAAAGTGGAGGGGAAAGGG + Intergenic
918769158 1:188531301-188531323 TTCAAAAAGAGGTGGGGATGAGG + Intergenic
919107596 1:193172710-193172732 GGCAAAAGGAAGAGGGAAAAAGG - Intronic
919125598 1:193389010-193389032 GTCAAAAAGGAGTAGTGACAGGG + Intergenic
919558131 1:199086787-199086809 CTGAGAAAGAAGTAGGGAAAAGG - Intergenic
919679718 1:200422235-200422257 GAGAAACAGAAATGGGGAAATGG + Intergenic
919969800 1:202567861-202567883 GTCAGAAAGAAGAGATGAAATGG - Intronic
920593881 1:207249185-207249207 GTCAAAAGGATGTGAGGACAGGG + Intergenic
921547807 1:216492977-216492999 GTTGAAAAGAAGTGGTGACAAGG - Intergenic
921719278 1:218452519-218452541 TTCCAAAAGAAGTGGGTAATTGG - Intergenic
922403376 1:225285137-225285159 GGTAAGAAAAAGTGGGGAAAGGG + Intronic
923235193 1:232026074-232026096 TTCTAAAAAAAGTGGGGAGAGGG - Intronic
924291606 1:242542443-242542465 ATGAACAAGAGGTGGGGAAAGGG - Intergenic
924381531 1:243469974-243469996 GTAACAAAGAAGGGTGGAAAGGG - Intronic
924568672 1:245218901-245218923 GCCAACAAGAACCGGGGAAAGGG - Intronic
1063280671 10:4626272-4626294 TTCAGAGAAAAGTGGGGAAAAGG + Intergenic
1063599257 10:7465088-7465110 GTAAAAGAGAATTGAGGAAAAGG + Intergenic
1064723486 10:18253688-18253710 GTGAGAAAGGAGAGGGGAAAAGG - Intronic
1066705063 10:38168580-38168602 GTAAAAAATAGGTGGAGAAAAGG + Intergenic
1066985418 10:42461974-42461996 GTAAAAAATAGGTGGAGAAAAGG - Intergenic
1068306496 10:55216440-55216462 GCCAAAAAGAAGTGGAGGAATGG + Intronic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1068997351 10:63222884-63222906 ACCAAAAAGAAGTGGGAAAGTGG + Intronic
1069125059 10:64620027-64620049 GTCCAAAAGGAGAGGAGAAAAGG + Intergenic
1069678711 10:70268163-70268185 TCCAAAGAGAAGTGGGGATATGG - Intronic
1069780122 10:70950160-70950182 GTGAGAAAGCAGTGGGGAGAGGG - Intergenic
1070279043 10:75035528-75035550 GGCAGAGAAAAGTGGGGAAAGGG - Intergenic
1070445336 10:76494216-76494238 GTCTAACAGAAGTGGGGAAGTGG + Intronic
1070913785 10:80139674-80139696 CTCAAAAAAAAGTGGGGAGGGGG + Intronic
1071155979 10:82689999-82690021 GGCAAAAAGAAGTAAGGAAATGG - Intronic
1071162926 10:82772469-82772491 GGCACAAGGGAGTGGGGAAAGGG - Intronic
1071277915 10:84073124-84073146 TTGACAAAGATGTGGGGAAAGGG + Intergenic
1071311299 10:84347227-84347249 GTCAAATAGAAAAGGGGGAAAGG - Intronic
1073518510 10:104101829-104101851 ATCAAACTGAAGTGGGGGAATGG - Intergenic
1073639154 10:105231551-105231573 GTTGAAAAGAAGTGGTGAGAGGG + Intronic
1073868781 10:107836867-107836889 GACAACTAGAAGTGGGGAAGGGG + Intergenic
1074206865 10:111290308-111290330 GTCAGAAAGAAGAGGGCAGAGGG + Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1074718016 10:116237856-116237878 GTCACAAGGAAGTGGGGAAAAGG + Intronic
1075143318 10:119861252-119861274 GTGAAAAAGAAGTAGGGATGGGG + Intronic
1075984280 10:126770196-126770218 GTCAATTAGATGTGGGGAGAGGG - Intergenic
1076033308 10:127177492-127177514 CTCAAACACAAGGGGGGAAAAGG - Intronic
1077347005 11:2065304-2065326 ATAAAAAAGATGTGTGGAAATGG - Intergenic
1077652951 11:3990956-3990978 CTCCAAAAGGAGTGGGGATAGGG - Intronic
1077798205 11:5513142-5513164 GACAAAAAGGAGCGGGGAATGGG - Intronic
1077957920 11:7040583-7040605 TTCAAAACAAAGTGGGGAAATGG - Intronic
1078344661 11:10536221-10536243 TTAAAAAAAAAGTAGGGAAATGG + Intronic
1078892725 11:15572125-15572147 AAGAAAAAGAAGTTGGGAAATGG + Intergenic
1079582865 11:22087842-22087864 GACACTGAGAAGTGGGGAAAAGG + Intergenic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1080782147 11:35439546-35439568 GCCAAACACAAGTGGGGAAGGGG + Intronic
1081908369 11:46683595-46683617 ATGAACAAGAACTGGGGAAAGGG + Intronic
1081966790 11:47174974-47174996 GTCAAGAACAACTGGGAAAACGG + Intronic
1083605872 11:63978618-63978640 GTCAAACAGAGGAGGAGAAAGGG - Intronic
1084073768 11:66756326-66756348 GAAAAAAAAAAGGGGGGAAAAGG - Intronic
1085077171 11:73601475-73601497 AGGAGAAAGAAGTGGGGAAATGG - Intergenic
1085984785 11:81772393-81772415 GCCAAAAAAAAGTGGGGGAGGGG - Intergenic
1086231003 11:84569739-84569761 GACAAAAAGAAATTGGGTAAAGG - Intronic
1086436550 11:86786663-86786685 ATAAAAAAGAGTTGGGGAAATGG - Intergenic
1086802025 11:91187634-91187656 TTAAAAAAGAAGCAGGGAAAAGG - Intergenic
1087293102 11:96340918-96340940 TTCAAAAGGGAGAGGGGAAATGG + Intronic
1087426517 11:97994129-97994151 GTTACAAAGAAGTCAGGAAAGGG - Intergenic
1087432911 11:98076136-98076158 GAGAAAAAGAAGCGGGGAGAGGG - Intergenic
1087594711 11:100238096-100238118 AGCAAAAAGTAGTGGAGAAAAGG + Intronic
1087622675 11:100560257-100560279 TGGAAAAAGAAGTGGGAAAAGGG - Intergenic
1087807589 11:102571796-102571818 GTGAAAGAGTAGTGGTGAAATGG - Intergenic
1088060896 11:105648250-105648272 TCCAAAAGGAAGTAGGGAAATGG + Intronic
1088180826 11:107107909-107107931 GTCGAATAGAATTGGTGAAAGGG - Intergenic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1088715754 11:112547917-112547939 GTCAAGAAGAAGAGGGGCCAGGG - Intergenic
1088905132 11:114149740-114149762 ATTAAAAAAAAGTGGGCAAAAGG + Intronic
1089182107 11:116590275-116590297 GGCAGAAAGAGGTGGTGAAAGGG - Intergenic
1089334227 11:117711831-117711853 GAATAAAAGAAGTGGGGAATGGG - Intronic
1089639798 11:119840086-119840108 GTCAAAAAGTAGTCTGTAAAAGG - Intergenic
1090247454 11:125226634-125226656 ATCTAAAAGAAGAGGGGAATAGG - Intronic
1090475295 11:127014782-127014804 GTCTTAAAGAAGTGGGGTCAAGG + Intergenic
1090898831 11:131006684-131006706 GACAAAAATATGTGGAGAAAAGG - Intergenic
1090911393 11:131122650-131122672 GTCAGGCAGAAGTGGGGAAAAGG + Intergenic
1090937238 11:131354026-131354048 GTCAACTTGAAGTGGGGCAAGGG - Intergenic
1090948509 11:131452104-131452126 CTCGAAAAGAAGTGGGGGGAGGG + Intronic
1092026002 12:5241078-5241100 GGCACAAAGTAGTGGGGAGATGG + Intergenic
1092210852 12:6645620-6645642 AACAAAAAGAAGTAGGGAAGAGG - Intronic
1092291113 12:7159942-7159964 GTCACAGAGAAGTCGGGGAAAGG - Intergenic
1093126539 12:15336428-15336450 GTAACCATGAAGTGGGGAAAAGG + Intronic
1093631670 12:21417850-21417872 GTCAAATAGAATTGTAGAAATGG + Intronic
1094314667 12:29125908-29125930 GTTCAAAAGAAGTGGTGAGAGGG + Intergenic
1095392799 12:41728851-41728873 GGCACAAAGCAGTGGGGAGAAGG + Intergenic
1096771251 12:53937394-53937416 GAGAAAAATAAGAGGGGAAAGGG - Intergenic
1097225215 12:57473095-57473117 GTCAGCATCAAGTGGGGAAATGG - Intronic
1097926149 12:65129527-65129549 GTCAAAAAGATGGGTGAAAATGG - Intergenic
1098094241 12:66937573-66937595 TTCAAAAAAAATTGGAGAAAGGG + Intergenic
1098397444 12:70035962-70035984 ATCAAAAAACAGTGGGGAACAGG - Intergenic
1098752737 12:74316541-74316563 GATAAAGAGATGTGGGGAAAAGG - Intergenic
1099570163 12:84306978-84307000 GACAAAAAAGAGTGGGAAAAAGG + Intergenic
1099661124 12:85563730-85563752 GTGCAAAAGAAAAGGGGAAATGG + Intergenic
1099748727 12:86743237-86743259 TTCACAAAGAACTAGGGAAATGG + Intronic
1099881641 12:88474435-88474457 GGCAGAAAGAAATGGGGAAGAGG - Intergenic
1099906091 12:88771965-88771987 TTCTAAAATAAATGGGGAAATGG + Intergenic
1099910337 12:88824321-88824343 GTAGGAAAGAAGTGGAGAAAAGG - Intergenic
1100440699 12:94614534-94614556 TTCAAAAAGATGTGGGAACAGGG - Intronic
1100577159 12:95903424-95903446 GACAAAAAGAAGTGGTGCAGTGG + Intronic
1101978675 12:109385856-109385878 GTAAAAAATAAGTGGGGAAGAGG - Intronic
1102208712 12:111108688-111108710 GGCAAAGAGAAGGGGGAAAATGG - Intronic
1102861834 12:116342737-116342759 AACAAGAAGAAGTGGGGAAATGG - Intergenic
1103222868 12:119260505-119260527 GGAAAAAAGAAATGGGGAGAGGG - Intergenic
1103387996 12:120549032-120549054 GGCAAAGTGATGTGGGGAAAAGG + Intronic
1104202426 12:126603010-126603032 GTTAAAAATAAGTGGGCAAATGG - Intergenic
1104455865 12:128911703-128911725 TTCAAAATGAACTGGAGAAATGG + Intronic
1104588781 12:130068042-130068064 TTCAAGAAAGAGTGGGGAAAGGG + Intergenic
1104711030 12:130986688-130986710 GTTAAAAAGGAGTGGTAAAAGGG + Intronic
1105368869 13:19785550-19785572 GTCAAAGAAAGGAGGGGAAATGG - Intergenic
1105637777 13:22232053-22232075 ATCAAAAAGCAGATGGGAAAAGG - Intergenic
1106421339 13:29588847-29588869 CTGAAAAAGAAAAGGGGAAAAGG + Intronic
1106796467 13:33210903-33210925 GACCAAAAGAAATGGAGAAATGG - Intronic
1106996050 13:35481455-35481477 CTGAAAAAAAAATGGGGAAAGGG + Intronic
1107228638 13:38081933-38081955 GATAAAAAAAATTGGGGAAAAGG + Intergenic
1108096507 13:46907380-46907402 GTCAAAAAGAAGAGGAGAAGAGG - Intergenic
1108886395 13:55188979-55189001 TTTAAAAAGCAGTGGGGGAAAGG - Intergenic
1109493251 13:63131716-63131738 GTCAAATAGAACTGGTGGAAGGG - Intergenic
1109881638 13:68486124-68486146 GTCTAAAAGAACTGGAGAAATGG + Intergenic
1110636373 13:77771055-77771077 GACAAAAAGCAGTGGGGGTAAGG - Intergenic
1110868161 13:80420478-80420500 GCAAAAAAGAAGTGGGGAGAAGG - Intergenic
1111063884 13:83064263-83064285 GTCAAAAAAAAGGGAGTAAATGG - Intergenic
1111260876 13:85738225-85738247 GTGAAAAAGAAGTGAGAAACAGG - Intergenic
1111433963 13:88181860-88181882 GTCAAAAAGATAGTGGGAAAGGG - Intergenic
1111824596 13:93251680-93251702 GTCATGAAGGAATGGGGAAAAGG - Intronic
1111845568 13:93504405-93504427 ATCATACAGAAGTGGGGAGAAGG - Intronic
1111924925 13:94452810-94452832 TTAAAAAAAAAGTGGGGGAAAGG + Intronic
1112960438 13:105119179-105119201 ATTAAAAATAAGTGGTGAAAGGG - Intergenic
1114027783 14:18544335-18544357 GGCACAAAGAAGTGGGAAATGGG + Intergenic
1114443665 14:22771198-22771220 GTGAAAAAGGACTAGGGAAAGGG + Intronic
1114577267 14:23726310-23726332 GTCAGAAAGAGGAGGGGAAGGGG - Intergenic
1114649131 14:24272045-24272067 GTGAAAAAGGGGTGAGGAAAGGG - Intergenic
1114984726 14:28211729-28211751 GTGAAGAAGATGTGGAGAAAAGG - Intergenic
1115050671 14:29058451-29058473 GTCAAAAAGAGGTGACAAAAAGG - Intergenic
1115270124 14:31542126-31542148 GGGAAAAGGAAGAGGGGAAAAGG - Intronic
1115654415 14:35429737-35429759 TTAAAAAAGTTGTGGGGAAATGG + Intergenic
1115829820 14:37325261-37325283 ATCAAAAAGACGAGGGTAAACGG - Intronic
1117140212 14:52782982-52783004 GTCTAAAAGAAGAGGGGCAGGGG + Intronic
1117661259 14:58007277-58007299 GTCAATAAGAAATGCAGAAATGG - Intronic
1117895497 14:60480956-60480978 GTAAAGAAAAAATGGGGAAAGGG + Intronic
1118749075 14:68793649-68793671 GTCGAAGAGAAGTCGGGAAAAGG - Intronic
1119582348 14:75797451-75797473 GTTGAATAGAAGTGGTGAAATGG + Intronic
1119851973 14:77872663-77872685 AAAAAAAAGGAGTGGGGAAAGGG - Intronic
1120078960 14:80193322-80193344 GTTAAAAAGAAGTGGTGAGAGGG - Intergenic
1120571165 14:86118023-86118045 GACAACAAGTAGTGGAGAAAGGG - Intergenic
1120658117 14:87220370-87220392 GGTAAAAAGAATTGGGGACAGGG - Intergenic
1120741930 14:88118103-88118125 ATCAAACAACAGTGGGGAAAGGG - Intergenic
1120753875 14:88223606-88223628 GTCAAAAAGAACTCGCCAAAGGG - Intronic
1124115231 15:26835733-26835755 GTCAAATAGAAGCAGTGAAAAGG + Intronic
1124357418 15:29006038-29006060 GTTAAATAGAAGTGGTGAAAGGG - Intronic
1124396904 15:29310136-29310158 GACAGAAATAAGTGGAGAAAAGG + Intronic
1124784623 15:32668307-32668329 GTGAAAAAGAAGTAGAGGAATGG + Intronic
1124884468 15:33672112-33672134 GTTAAAAAGAAGGTGGGAAAGGG - Intronic
1125249976 15:37689917-37689939 ATAAAAAATAAGTGTGGAAAGGG - Intergenic
1126702348 15:51379829-51379851 GTCCAAAAGAAGCAGGAAAAAGG + Intronic
1127314897 15:57785589-57785611 GTTTCAAAGAAGGGGGGAAAAGG + Intergenic
1127602871 15:60555878-60555900 GGCAAGAAGGAGTGGGGAAGAGG - Intronic
1127891574 15:63256573-63256595 GTCAAAAGAAAGAGGGGAGAAGG + Exonic
1128426506 15:67546713-67546735 TACAAAAAGAAGAGGGGAGAGGG - Intronic
1129853488 15:78809195-78809217 GTCAGTCACAAGTGGGGAAAAGG + Intronic
1130550177 15:84885429-84885451 GGAAAAAAAAAGTGGAGAAAAGG + Intronic
1130621169 15:85464028-85464050 GACAAAAAGAAGTAGGAACAGGG - Intronic
1131386766 15:92014551-92014573 GCTAAAAAGCAGTGGGAAAATGG + Intronic
1131793736 15:95991970-95991992 GGCAAGAAGCAGTGGGGGAAAGG - Intergenic
1131957667 15:97754532-97754554 AACAAAAAAAAGTGGGGAAGGGG + Intergenic
1132115600 15:99133526-99133548 TTCAAAAAGAAATGGGAAATAGG + Exonic
1133626775 16:7577468-7577490 GTCTAAGAGAAGAGGTGAAAAGG - Intronic
1133705510 16:8350838-8350860 GAAAAAAAGGAGAGGGGAAAGGG + Intergenic
1134052712 16:11147952-11147974 GTCAAAAAGAAATGGAAAAAAGG - Intronic
1134481223 16:14621119-14621141 TTAAAAAAGAAGTGGGGGTAGGG - Intronic
1135416297 16:22270549-22270571 GTCAAAAAGAATCGGGGAGCTGG - Intronic
1135635407 16:24071463-24071485 GACAAACAGGACTGGGGAAAAGG + Intronic
1135639056 16:24104545-24104567 GTAAACAAGAAATGGGGACAAGG + Intronic
1136363687 16:29798532-29798554 GTCAGAAAGGGCTGGGGAAACGG + Intronic
1137295880 16:47092966-47092988 GACAAAGAAGAGTGGGGAAACGG - Intronic
1137891516 16:52167675-52167697 GGTATAAAGAAGTGGGGGAAAGG - Intergenic
1138187524 16:54987719-54987741 GGGGAAAAGAAGTGGGCAAAAGG - Intergenic
1138434996 16:56993303-56993325 GTTAAAAAGAAAGAGGGAAAGGG - Intronic
1138624135 16:58235997-58236019 GTCTCAAAGAAGTGGGAAAGGGG - Intronic
1139097612 16:63723899-63723921 GAAAAGAAGAATTGGGGAAAAGG + Intergenic
1140747669 16:77995447-77995469 GGAAAAAAAAAGTGGGGGAAAGG + Intergenic
1140786825 16:78350430-78350452 GAGAAAAGGAAGTGGGGAAAAGG - Intronic
1140810203 16:78569768-78569790 GTCAATAAGAAGAGGATAAAAGG - Intronic
1141741733 16:85898339-85898361 GTAAAAATGAAGTGGGGGAGAGG - Intergenic
1142201141 16:88761714-88761736 GTCAGGAGGAAGTGGGGGAAGGG - Intronic
1143231994 17:5364231-5364253 CAGAAAAAGAAGTGGGAAAAGGG + Intronic
1143308138 17:5965273-5965295 GTTAAAAAGAAGTGGTGAGAGGG + Intronic
1143919763 17:10321797-10321819 GCCAAAAAGAAAAGGGAAAAAGG - Intronic
1144122118 17:12165425-12165447 GGCAAAAAGAAGAGGGTACAAGG + Intergenic
1144301864 17:13928655-13928677 CTGAAAAAGGAGTGGGCAAAGGG + Intergenic
1144715850 17:17435406-17435428 GTCAGAAATACGTGGAGAAAAGG + Intergenic
1145279796 17:21458636-21458658 GGTACAAAGAACTGGGGAAAGGG + Intergenic
1145997438 17:29112742-29112764 GGAAAAAAGAAGTGAGAAAAGGG + Intronic
1146755391 17:35427441-35427463 GTCAACAAGAATAGGAGAAAGGG - Intronic
1146803890 17:35849788-35849810 GTTAATAAAAATTGGGGAAATGG + Intronic
1148183483 17:45623787-45623809 GGAAAATAGAAGTGGGGAGAGGG + Intergenic
1148330943 17:46813642-46813664 GGGAAAAGGAAGTGGGAAAAAGG - Intronic
1148745323 17:49914780-49914802 ATCAACAAGAAGTGGGGAGCGGG - Intergenic
1149949768 17:60973227-60973249 GGCAATAAGAAGGGGAGAAAGGG + Intronic
1150307091 17:64094788-64094810 GAAAAAATGAAGTGGGGACATGG - Intronic
1150511774 17:65760291-65760313 GTTAAAAAGGAGTGGTGAGAGGG + Intronic
1151079190 17:71308842-71308864 GTTGAATAGAAGTGGTGAAATGG - Intergenic
1151085898 17:71380312-71380334 GTCAAAAAGAGGTTGGGGAAAGG - Intergenic
1151483402 17:74383625-74383647 GAAAGAAAGAAGTGGGGCAAGGG - Intergenic
1151524181 17:74652637-74652659 GAAGAAAAGAAGAGGGGAAAGGG - Intergenic
1153093977 18:1380522-1380544 GACAAAAGGAAGTTGAGAAATGG + Intergenic
1153127612 18:1813957-1813979 GCTAAAATGAAGTGGAGAAAAGG + Intergenic
1153131962 18:1864440-1864462 ATCAACAGGAAGTGGGGCAAGGG + Intergenic
1153341164 18:3976355-3976377 CTCAAAAAAAAGTGGTTAAAAGG + Intronic
1153647444 18:7207845-7207867 ATTAAAAAAAAGTGGGGAAGGGG - Intergenic
1154034886 18:10791300-10791322 GCCAAAAAGTAATGGTGAAAAGG + Exonic
1155545360 18:26909036-26909058 TTCAGAATGAAATGGGGAAATGG - Exonic
1156954139 18:42941161-42941183 GGCAAAAAGAAATGAGCAAATGG + Intronic
1157242610 18:46025179-46025201 GACAAAAAGCAGTGGGGAGAGGG - Intronic
1158061238 18:53345940-53345962 ATCCAAAAGAAGTCAGGAAAGGG - Intronic
1158091297 18:53716906-53716928 GACAAACAGAAGTGGGGCGAAGG - Intergenic
1158226426 18:55206015-55206037 ATCAGAAGGAAGTGGGGAAAAGG + Intergenic
1158292677 18:55958868-55958890 TTTAAACAGAAGTGGGGAAAGGG + Intergenic
1158664702 18:59421980-59422002 GTCAGAAAGGAGTGGGAAATGGG + Intergenic
1159178448 18:64869387-64869409 GACAAAAAGAAATAGAGAAATGG - Intergenic
1159209894 18:65305043-65305065 ATAAAACAGAGGTGGGGAAAAGG - Intergenic
1159547313 18:69855626-69855648 ACCAAAAAAAAGAGGGGAAAAGG + Exonic
1161680918 19:5679413-5679435 GGCAGAAAGAACTGGTGAAAAGG + Intronic
1161709860 19:5841785-5841807 GAGAAAGAGAAGTTGGGAAAGGG + Intergenic
1161713629 19:5863669-5863691 GAGAAAGAGAAGTTGGGAAAGGG + Intergenic
1161716065 19:5876937-5876959 GAGAAAGAGAAGTTGGGAAAGGG + Intronic
1164257893 19:23545216-23545238 GTCAAAAAGAAGAAGAAAAAAGG + Intronic
1164268352 19:23643680-23643702 GTCAAAAATAAGTTGGGGGAAGG + Intronic
1164434884 19:28220484-28220506 GTGAAGACGGAGTGGGGAAAGGG - Intergenic
1166588531 19:43973360-43973382 GTTGAACAGGAGTGGGGAAAGGG - Intronic
1166964838 19:46523001-46523023 ATTAAAAAAAAGTGGGGACAGGG + Intronic
1167409040 19:49334159-49334181 CACAAAAACAAGTGGGGAAGGGG + Intergenic
925192437 2:1895591-1895613 GAGAACAAGCAGTGGGGAAATGG + Intronic
925700297 2:6630011-6630033 GTCAAAAAGTAGTTGGTAGAGGG + Intergenic
925806834 2:7658972-7658994 GTCATACAGAAGCGGGGACAGGG - Intergenic
926252680 2:11164980-11165002 GTCAAATAGAAAAGGGGGAAAGG - Intronic
926361730 2:12094367-12094389 GACAAAAAGATGTTGGGAAAGGG - Intergenic
926865418 2:17351886-17351908 GTAAAATTGAAGTGAGGAAAAGG + Intergenic
926971959 2:18475408-18475430 GTGAAAGACAAGTGGGGAAAAGG - Intergenic
927314381 2:21665067-21665089 GAAAAAAAGAAGTGGGTAATGGG - Intergenic
927939472 2:27094709-27094731 CTCCAAAAGGAGTGGGGAGAGGG - Intronic
928268493 2:29832959-29832981 GGCAAAGAGAAGTAGGGAGAGGG + Intronic
929061450 2:37928911-37928933 GTCCAAAAGAAGGCAGGAAAAGG - Intronic
929867593 2:45731395-45731417 CCAAAAAAGAAGTGGGGAGATGG + Intronic
929967151 2:46543846-46543868 GCCACAAAGAACTGGGGAACAGG - Intronic
930665271 2:54095332-54095354 GTGGAATAGAAGTGGGGGAAAGG - Intronic
930982904 2:57549615-57549637 GTCAAATTGCAGTAGGGAAATGG - Intergenic
931730791 2:65151743-65151765 GACAAACAGAAGTGGGAGAAAGG - Intergenic
931748607 2:65311915-65311937 ATAAAGAAGGAGTGGGGAAAGGG + Exonic
931824487 2:65985688-65985710 GTCAAAAAAGAAGGGGGAAATGG + Intergenic
932035690 2:68244578-68244600 GTTAAAAAGAAGAGGATAAAAGG - Intronic
932291732 2:70586322-70586344 TTAAAGAAGACGTGGGGAAATGG - Intergenic
932605911 2:73165513-73165535 CTTAAAATGGAGTGGGGAAAAGG - Intergenic
932906151 2:75754545-75754567 GACAAAGAAAAGTGGGGAGATGG - Intergenic
933249673 2:80015244-80015266 GGCCAAAAGAAGGGGGGAAAAGG - Intronic
933551235 2:83779019-83779041 ATCCAAAATAAGTGGGGAAATGG - Intergenic
933700260 2:85250071-85250093 TAGAAAGAGAAGTGGGGAAATGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934718501 2:96556918-96556940 GTTAAAAAGCAGTGAGGTAAAGG - Intergenic
935443464 2:103131224-103131246 AGCAAAAAGAAAAGGGGAAAAGG + Intergenic
935527231 2:104185095-104185117 GTCCAAAAGAAGTCAGAAAAAGG - Intergenic
937060462 2:118977017-118977039 GTCAAAATGTGGTGGAGAAATGG + Intronic
937732954 2:125257198-125257220 CACAAAAATAAGTGTGGAAATGG - Intergenic
938172875 2:129097308-129097330 GTAAAAAATAAGTGGGTGAAGGG - Intergenic
939141240 2:138357277-138357299 CTCAGTAAGAAGTGGTGAAAGGG + Intergenic
939154066 2:138502779-138502801 CTCAAAAAGAATTAGGAAAAAGG - Intronic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940103214 2:150066661-150066683 GCCAAAATGAAATGGAGAAATGG + Intergenic
940156221 2:150659813-150659835 GGCAAAAAGAAATGGGTAACAGG + Intergenic
940563000 2:155325483-155325505 GTCCAGAAGAACTGGGCAAAGGG + Intergenic
940905536 2:159166162-159166184 ATCAGAAAGAAGTTGGGTAATGG + Intronic
941358362 2:164520237-164520259 AACAAAAAAAAGTGGGAAAAAGG + Intronic
941505938 2:166345523-166345545 AACAAAAAAAAGTAGGGAAAAGG + Intronic
941837137 2:170036205-170036227 GTTGAAAAGAAGTGGGGAGTGGG + Intronic
942309585 2:174642836-174642858 AGCAAAACAAAGTGGGGAAAAGG - Intronic
942523246 2:176826560-176826582 AACAAAAAGAGGAGGGGAAAGGG + Intergenic
944893086 2:204137345-204137367 GTCAAAAGTGAGAGGGGAAAGGG - Intergenic
945729600 2:213517686-213517708 GACAAAAACAAATGGAGAAAGGG + Intronic
946630449 2:221661908-221661930 GTGAAAAAGACATTGGGAAAAGG - Intergenic
947009541 2:225550567-225550589 CATAAAAAGAAGTAGGGAAATGG + Intronic
947033243 2:225822065-225822087 GTCATAAAGAAGTGAGCGAATGG - Intergenic
947249903 2:228090287-228090309 GTCCAAAAGAAGGGGGTAATAGG - Intronic
947335144 2:229074384-229074406 GACAAACAGAAATGAGGAAAAGG + Intronic
947464553 2:230330281-230330303 GTTCACAATAAGTGGGGAAAAGG - Intronic
948018933 2:234714488-234714510 GTCAAGAAGAAGGGGTGGAATGG - Intergenic
948187792 2:236034983-236035005 GCCAGAAAGGAGTGGGGAAAGGG + Intronic
1169985922 20:11444168-11444190 TGGAAAAAGAAGTGGGGCAAAGG - Intergenic
1170207689 20:13816777-13816799 TTCAAAAAGAAATGGGTACAAGG - Intronic
1170407652 20:16055695-16055717 GGCAAACACAAGTAGGGAAAAGG - Intergenic
1170713064 20:18809574-18809596 GTCAAACAGAATAGGGGAATGGG - Intergenic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1173634107 20:44539846-44539868 GGAAAAAAGAAGAGGAGAAATGG - Intronic
1174084576 20:47997520-47997542 GTTGAAAAGCAGTGGGGAGAAGG + Intergenic
1174290183 20:49502845-49502867 ATAAAAAAGAAGGGGTGAAATGG - Intergenic
1174703183 20:52630047-52630069 GTCAAAAAGCAGTGTGGAGCTGG - Intergenic
1175744044 20:61441451-61441473 GTTAAATGGCAGTGGGGAAAGGG - Intronic
1175838029 20:62008691-62008713 GTCACACAGGAGTGGGGAGAGGG + Intronic
1177442542 21:21145625-21145647 GCCAAAAAGAAGTGGGTAAGAGG + Intronic
1177637199 21:23802640-23802662 GAAAAAAAAAAGTGGGGAAGGGG + Intergenic
1178613732 21:34111451-34111473 TTCAAATAGAAGTGGGGGAGGGG - Intronic
1178862959 21:36304631-36304653 GTAAAAAAAAAGTGGGGAAGTGG + Intergenic
1179049342 21:37875402-37875424 GTCAAAAAGCACTGGGAAGAAGG - Intronic
1179066543 21:38029957-38029979 GCCAAAAAAGAGTGGGGAGAGGG - Intronic
1179659271 21:42864222-42864244 GTCATCAAGAAATGGGGGAATGG + Intronic
1179815004 21:43899869-43899891 GTCAAGAAGAAATTGGGAAGAGG + Intronic
1180451908 22:15471384-15471406 GGCACAAAGAAGTGGGAAATGGG + Intergenic
1181936534 22:26442884-26442906 GACAAAAGGAAATGGGGAGATGG - Intronic
1182077353 22:27504247-27504269 GGACCAAAGAAGTGGGGAAAAGG + Intergenic
1182901472 22:33901926-33901948 GCCAAAAAGATGTGGGGAGTAGG - Intronic
1183322789 22:37175465-37175487 GGCAAAAAGCAGAGGGGGAAAGG + Intergenic
1183988963 22:41585217-41585239 ATAAACAAGAGGTGGGGAAAAGG + Intronic
949389898 3:3548859-3548881 GTTAAATAGAAGTGGTGAAAAGG + Intergenic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
950843990 3:15996755-15996777 TTCAACAAGGAGAGGGGAAAAGG - Intergenic
952107317 3:30085280-30085302 CTAAATAGGAAGTGGGGAAAAGG + Intergenic
952303875 3:32128346-32128368 GTGGAAAGGAACTGGGGAAAAGG - Intronic
952920301 3:38279316-38279338 ACCAGATAGAAGTGGGGAAAGGG + Intergenic
952937954 3:38415428-38415450 GCCAAATGGAAGTGGGGATAAGG + Intronic
953326702 3:42017492-42017514 TTTGAAAAGAAGGGGGGAAAAGG - Intronic
953368925 3:42370920-42370942 GACAAAAGGAGATGGGGAAAAGG - Intergenic
953873792 3:46652118-46652140 GTTGAAAAGGAGTGGTGAAAGGG - Intergenic
954363737 3:50135585-50135607 TTAAAAAAGAAGTGGAGGAAGGG + Intergenic
955067024 3:55542689-55542711 GTCAATGAGAAGGGGAGAAAGGG - Intronic
955294390 3:57721825-57721847 CCCAAAAAGGAGTGGGGAATTGG - Intergenic
955793056 3:62607950-62607972 GTCTTAAAGAATTGGGGAAATGG + Intronic
957608374 3:82433771-82433793 TCCATAAAGAAGTGGGCAAAGGG - Intergenic
957848431 3:85771689-85771711 ATCAAAAAGAAATGGAGAACAGG + Intronic
957867535 3:86043943-86043965 GAAAACAAGAAATGGGGAAACGG + Intronic
959032925 3:101323178-101323200 GTTCACAAGAAGTGGTGAAAAGG + Intergenic
959753546 3:109868118-109868140 GTTGAAAAGAAGTGGTGAGAGGG - Intergenic
960096107 3:113691337-113691359 GTGAATAAGAAGTGAGGAAGAGG - Intronic
960295066 3:115933026-115933048 GAGAAAATAAAGTGGGGAAATGG + Intronic
960817761 3:121690074-121690096 ATTAAAAGGAAGTGGGTAAATGG + Intronic
960988242 3:123294382-123294404 GTCAAATACAAAGGGGGAAAAGG + Intronic
962068326 3:132007238-132007260 GTCAAAAAGAAGTGAAGACAGGG - Intronic
962645548 3:137435390-137435412 AAAAACAAGAAGTGGGGAAAGGG + Intergenic
962950560 3:140214595-140214617 GTTAGAAAGATGTTGGGAAAGGG - Intronic
963723055 3:148886205-148886227 GTAAAAAATAATTAGGGAAAAGG - Intronic
964283906 3:155097013-155097035 GTGAAAAGGAAGTGAGGAAAAGG + Intronic
964853896 3:161124257-161124279 GTTAAAAAGCAGTGGTGAGAGGG - Intronic
965755747 3:172025430-172025452 GTCAAAAGGATAAGGGGAAAAGG - Intergenic
966077692 3:175957782-175957804 GACAATAAGAAGAGAGGAAATGG + Intergenic
966168484 3:177049697-177049719 GTCAAGTAGAAGTGTGAAAATGG - Intronic
966489732 3:180514894-180514916 AGAACAAAGAAGTGGGGAAAAGG + Intergenic
966545779 3:181145979-181146001 GTTGAAAAGCAGTGGTGAAAGGG - Intergenic
966549646 3:181190408-181190430 GTAAGAAAGTAGTTGGGAAAAGG - Intergenic
967296120 3:187966777-187966799 GTCAAAGAAAAGAGGGGGAAAGG - Intergenic
967757531 3:193186900-193186922 CTCAAAAGAAAGTCGGGAAAGGG - Intergenic
969887953 4:10233249-10233271 GTCAAAAGGAACTGAAGAAATGG - Intergenic
970452359 4:16182770-16182792 GTTAAAATGAAGTGAAGAAAAGG + Intronic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
970856775 4:20658346-20658368 GGCAAAAAGAACTGGAGAATTGG + Intergenic
971226431 4:24757086-24757108 GAACAAGAGAAGTGGGGAAAAGG - Intergenic
971400801 4:26273717-26273739 TTCAGGAAGAAGTGGGGAAGTGG + Intronic
972386534 4:38572065-38572087 GAAAAAAAAAAGTGGGGGAAGGG + Intergenic
972549706 4:40118956-40118978 GTTAAAAAGGAGTTGGGAATGGG + Intronic
972943990 4:44230515-44230537 GTAAAAAAGATGATGGGAAATGG - Intronic
973085113 4:46048930-46048952 GTCAACAAGATGTCAGGAAAAGG + Intronic
973254521 4:48095768-48095790 GATAAAAAGAAGTGGTAAAAGGG + Intronic
973721114 4:53724543-53724565 GAAAAAAAGAAGTGGGGAGGAGG - Intronic
976505075 4:85836968-85836990 GCCAAAAAGGAGGGGGAAAAAGG + Intronic
976634564 4:87275001-87275023 GTCCAAAGGAAGTGGGAAAGAGG - Intergenic
976839883 4:89419761-89419783 GACAAAAAGAAATGGTGAAGGGG - Intergenic
976868854 4:89765835-89765857 GTCAAGTAGATGTGGGAAAAAGG - Intronic
976896314 4:90116243-90116265 GTCCAGAATCAGTGGGGAAATGG + Intergenic
976920452 4:90434883-90434905 GACGAAAAGAAGTGGGGAAAAGG - Intronic
977401137 4:96534123-96534145 GAGAGAAAGAAGTGGGGAAATGG - Intergenic
977751979 4:100620610-100620632 GACAGGAACAAGTGGGGAAAGGG + Intronic
978498837 4:109387075-109387097 GCCAAAAACATGTGGGGAAAGGG + Intergenic
978582580 4:110247051-110247073 GTGATAAAGAAGTGAAGAAAGGG - Intergenic
978603823 4:110457219-110457241 GTTAAAAAGAGGTAGTGAAAGGG + Intronic
978791382 4:112666615-112666637 GACGAAAAGAAGTGAAGAAAAGG - Intergenic
979820152 4:125161013-125161035 GTCCAAAAGAAAGGGGTAAAAGG + Intergenic
979841520 4:125447951-125447973 GTCATAAAACAGTGGGGACAAGG + Intronic
981227487 4:142313803-142313825 GTGAAAAAGCAGAGGGAAAAGGG - Intronic
981406487 4:144375757-144375779 GTAAGAAAGAAGTGAGGCAAGGG + Intergenic
981472012 4:145146900-145146922 GTCATAAACAAGTGGGAAGATGG - Intronic
981551802 4:145949042-145949064 GTGATAAAGAAGTGTTGAAAGGG - Intergenic
981651496 4:147064443-147064465 AACAAAAGGAAATGGGGAAAAGG - Intergenic
981756297 4:148144563-148144585 TTTAAAAAGAAGTAGGGGAAAGG + Intronic
981928061 4:150161035-150161057 GTCAAAAAGAAATGACAAAAAGG + Intronic
982072436 4:151707185-151707207 GTCAGAAAGAAGGTGGTAAATGG + Intronic
982667575 4:158284875-158284897 GTCAGAAAGAAATGGCCAAATGG + Intergenic
983021345 4:162679392-162679414 GTTAAATAGGAGTGGTGAAAGGG - Intergenic
983333549 4:166362023-166362045 TACCAAAAAAAGTGGGGAAAGGG - Intergenic
983384612 4:167043489-167043511 GTTGAAAAGCAGTGGTGAAAAGG + Intronic
983962057 4:173766724-173766746 GTCCAAAAGAAGTGGCCAAGCGG - Intergenic
984580890 4:181508927-181508949 TTAAAAAAGAAGTTGGGAAGGGG + Intergenic
984869673 4:184315133-184315155 TGCAAAAACACGTGGGGAAAAGG + Intergenic
984935105 4:184882959-184882981 GGCACAAATAAGTGGGGAGAGGG - Intergenic
985345309 4:188998709-188998731 GTCAAATAGGAGTGGTGAGAGGG + Intergenic
985561459 5:588590-588612 GTGAAAATGAAGTGGTGACAAGG + Intergenic
986096570 5:4561065-4561087 ATCAGAAAGAAGTTGGAAAAAGG + Intergenic
987472208 5:18346288-18346310 GTTGAATAGAAGTGGGGGAAGGG + Intergenic
987696761 5:21342422-21342444 GTTAAAAAGAAGAGGTGGAAAGG + Intergenic
988050326 5:26021101-26021123 GACAAAAAGAACTGGGAAGAGGG - Intergenic
988312497 5:29578928-29578950 GTCATAAAGCAGTGGTCAAATGG - Intergenic
988474574 5:31572480-31572502 GTAAAAAAGAAGTGGGGGTGGGG + Intergenic
988636914 5:32994777-32994799 GTTAAAAAAAAGGGGGGAGAGGG - Intergenic
988755445 5:34244124-34244146 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
989956205 5:50363513-50363535 GTCATGAAGAAGTAAGGAAAAGG + Intergenic
990405480 5:55486239-55486261 CTCAAAGAAAAATGGGGAAAGGG - Intronic
991017763 5:61949727-61949749 ATTCAAAAGAAGTGGGAAAAAGG + Intergenic
991156182 5:63439126-63439148 GTGAAAAAAAAGAGAGGAAAGGG - Intergenic
991743680 5:69709852-69709874 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
991754028 5:69845383-69845405 GTTAAAAAGAAGAGGTGGAAAGG + Intergenic
991795253 5:70289584-70289606 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
991803653 5:70402138-70402160 GTTAAAAAGAAGAGGTGGAAAGG + Intergenic
991823052 5:70585127-70585149 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
991833345 5:70720503-70720525 GTTAAAAAGAAGAGGTGGAAAGG + Intergenic
991887619 5:71289103-71289125 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
992033018 5:72742850-72742872 GTCAGAAAGTACTGGGGAATAGG + Intergenic
992119592 5:73577371-73577393 GAAAAAAAGATGTGGGGAGAAGG + Intronic
992318167 5:75581254-75581276 TTCAAAAAGTAGTGGAGAGATGG - Exonic
992728185 5:79630574-79630596 CTCAAAAAGTAGTGGGGATGGGG + Intronic
992778293 5:80106642-80106664 GTGAACAAGAAGTGGTGCAAGGG + Intergenic
992989972 5:82274266-82274288 GACACAAGGCAGTGGGGAAAGGG + Exonic
993226588 5:85173545-85173567 GTCCATAAGGAGGGGGGAAAGGG + Intergenic
993581098 5:89661775-89661797 GGAAAAAATAAGTGGGGAAAGGG - Intergenic
993930140 5:93927813-93927835 GTAAAAAAGAGGAGGGGAGAGGG + Intronic
994537634 5:101051282-101051304 GTCAAAATGTACTGGAGAAATGG + Intergenic
994618793 5:102138147-102138169 GTCAAGTAGAAGTGAAGAAATGG - Intergenic
995155475 5:108907209-108907231 GACAAAAAAAAGAGGGAAAAAGG - Intronic
995750866 5:115452053-115452075 GACACAGAGAGGTGGGGAAAGGG - Intergenic
995849144 5:116526126-116526148 ATAAAAAAGAAGGGGGGAAAAGG - Intronic
995977776 5:118062089-118062111 GTCACAAGGCTGTGGGGAAAAGG - Intergenic
996073053 5:119156808-119156830 TTCATAAAGAAGTGGCGAAAAGG - Intronic
996374581 5:122790897-122790919 GTTGAAAAGAAGTGGTAAAAGGG + Intronic
996433626 5:123409377-123409399 GTTGAAAAGAAGTGGTGAGAGGG - Intronic
997488237 5:134250012-134250034 TTCAAAAAGAAGTGTAGAGAGGG - Intergenic
998656374 5:144184921-144184943 ATCAAAAAGAACAAGGGAAATGG - Intronic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
999398184 5:151244146-151244168 GTCAAAAGGAGGTGGGTAATGGG + Intronic
999812818 5:155144029-155144051 CTCAGAAAGAAGGGAGGAAAAGG - Intergenic
1000137269 5:158364929-158364951 GTTCAAATGAAGAGGGGAAAAGG + Intergenic
1000221925 5:159222716-159222738 AACAAAAAGAGGTGGGGAGATGG - Intergenic
1001170719 5:169416604-169416626 CTCAAAAAGACATGGGGGAAGGG + Intergenic
1001686275 5:173597140-173597162 ATCCAAAAGATGTGGGAAAAGGG - Intergenic
1003438685 6:6120132-6120154 GCTAAAAAGAAGTGGGTTAAAGG - Intergenic
1003456865 6:6291479-6291501 GTCAAGGAGATGTGAGGAAATGG - Intronic
1004016404 6:11735940-11735962 GCCAAAAAAAAGTAGGGAGAGGG - Intronic
1004525744 6:16405853-16405875 GTGAAAGAAAAGTCGGGAAATGG + Intronic
1005454024 6:26001447-26001469 AGCAAATAGAAATGGGGAAAAGG - Intergenic
1005554076 6:26955896-26955918 GTTAAAAAGAAGAGGTGGAAAGG - Intergenic
1005575549 6:27186137-27186159 ATAAAACAGAAGAGGGGAAATGG + Intergenic
1005855036 6:29853872-29853894 GATACACAGAAGTGGGGAAATGG + Intergenic
1006725167 6:36194346-36194368 GAAAGAAAGAGGTGGGGAAATGG + Intergenic
1006877229 6:37308376-37308398 AGCAAAAAGCAGTGGAGAAAGGG - Intronic
1007000920 6:38311715-38311737 TTGACAAAGATGTGGGGAAAAGG - Intronic
1007509503 6:42364406-42364428 GTCTAAGGGAAGTGGGGAAAGGG - Intronic
1008849554 6:56008303-56008325 GACAAAAAGCAGGAGGGAAATGG - Intergenic
1009437851 6:63637567-63637589 GAGAAAAATTAGTGGGGAAAAGG - Intronic
1010208616 6:73345427-73345449 GTCAAAATGAGGTGGGGTGAGGG - Intergenic
1010497877 6:76557783-76557805 CTAAGTAAGAAGTGGGGAAAAGG - Intergenic
1012328334 6:97952420-97952442 GTTAAGAAGCAGTGGTGAAAGGG + Intergenic
1012459534 6:99445020-99445042 GTCAGAGAGAAGTGGAGAAAGGG - Intronic
1012719185 6:102719776-102719798 GCCAAAAATAAGCGAGGAAAAGG - Intergenic
1012828688 6:104179691-104179713 GCCAAAGTGAAGTGGGGCAAGGG - Intergenic
1013049145 6:106514937-106514959 GTCACAAAGAAATGGGTCAAAGG - Intronic
1013417511 6:109938195-109938217 GACAAAAAGTAATGGAGAAAAGG - Intergenic
1013869520 6:114740394-114740416 TTAAAAAAGAAGAGGAGAAAAGG + Intergenic
1014144810 6:117985690-117985712 GTCAAAAAGAAATGAGTCAATGG - Intronic
1014243336 6:119041656-119041678 GACAAACAGCAGTGGGGAACTGG - Intronic
1014354363 6:120386682-120386704 AAAAAAAAGGAGTGGGGAAAGGG - Intergenic
1014701163 6:124690473-124690495 GTTGAAAAGAAGTGTTGAAAGGG + Intronic
1014936131 6:127387277-127387299 GTCAATCAGAAGAGGGGATATGG - Intergenic
1015695474 6:135975486-135975508 GTCCAAAGGCAGTAGGGAAAGGG - Intronic
1017555762 6:155565491-155565513 GTTAAGTAGAAGTGGTGAAAGGG + Intergenic
1018125017 6:160673937-160673959 GTCAAAAAAAATTGAGGAAGAGG + Intergenic
1019182800 6:170202279-170202301 GTCAAAGGGAAGTGGTGAGAGGG - Intergenic
1019531799 7:1506900-1506922 TTCAAAAAGAGGCGGGGAGAGGG - Intergenic
1020367988 7:7400736-7400758 GTGAAAAAGAAGTACAGAAATGG - Intronic
1020924283 7:14305253-14305275 GTCAAAAAGAGGTTGGTTAATGG - Intronic
1021712244 7:23427376-23427398 TTCAAGAAGAAGTGAGGGAAGGG - Intronic
1022251962 7:28617299-28617321 GTAAAAAAGAAATGGGAAATGGG - Intronic
1022382680 7:29875135-29875157 GTCAGAAAGTTGTGGAGAAAGGG - Intronic
1022433532 7:30354157-30354179 GAGAAAAAAAAATGGGGAAAGGG + Intronic
1022466972 7:30658479-30658501 GTCAAAAAGACCTGGAGAAATGG + Intronic
1022714772 7:32889781-32889803 GGCAAAGAGAAGAGGGGAAGGGG + Intronic
1022834640 7:34102136-34102158 GGCAAAAAAAAATGGAGAAAAGG - Intronic
1023064307 7:36361264-36361286 ATCTAAAAGAATGGGGGAAAAGG + Intronic
1023489632 7:40725071-40725093 CTCAATGAGAAGTGGGGAACAGG - Intronic
1023878163 7:44302862-44302884 GTCGAATAGCAGTGGTGAAAGGG - Intronic
1023891187 7:44393088-44393110 GTGAGGAAGAAGTGGGGACAGGG - Intronic
1024032419 7:45473926-45473948 GTTGAAAAGAAGTGGTGAGAAGG - Intergenic
1024465584 7:49708962-49708984 GCCAGGGAGAAGTGGGGAAAGGG + Intergenic
1025731428 7:64112028-64112050 GTTATAAAGAAGAGGGCAAATGG + Intronic
1025857526 7:65295995-65296017 GTTGAATAGAAGTGGTGAAAGGG + Intergenic
1026298448 7:69076925-69076947 GTCAAAGAGCAGAGAGGAAACGG + Intergenic
1026305846 7:69141088-69141110 TTAAAAAAAAAGTGGGGGAAAGG + Intergenic
1026612849 7:71875712-71875734 GTGAAAAAGAGGTGGGGTAAGGG + Intronic
1026814151 7:73496247-73496269 ATCAAAAAGAAGAGGGAAACTGG + Intronic
1027673950 7:81136314-81136336 GTGAGAAAGAAGTGGTGAGAGGG - Intergenic
1027941445 7:84686193-84686215 CTTAAAAAGAAAGGGGGAAAGGG - Intergenic
1028280116 7:88914189-88914211 ATGAAAAAGAAGTTTGGAAATGG + Intronic
1028471041 7:91206508-91206530 GCCAAAAGGAAGTACGGAAAGGG + Intronic
1028973671 7:96888439-96888461 TTCAAAAATAATTGGGGAAAGGG + Intergenic
1028977182 7:96927012-96927034 GTCTAAAACAAGTGCGGCAAAGG - Intergenic
1029311764 7:99673799-99673821 GAAAAAAAGAAGAGGGGAATAGG + Intronic
1029316630 7:99721521-99721543 GAAAAAAAGAAGAGGGGAATAGG + Intronic
1029445158 7:100607808-100607830 GTAACAGAGATGTGGGGAAATGG + Intronic
1030186565 7:106768202-106768224 GTGAAACAGAAGTGAGGAATAGG - Intergenic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1031439737 7:121779279-121779301 GTCATAAAGAGGGGAGGAAATGG - Intergenic
1031683504 7:124703923-124703945 GATAAAGAGAAGTGGGTAAAAGG - Intergenic
1031744199 7:125472750-125472772 GGGAAAATGAGGTGGGGAAATGG + Intergenic
1032136891 7:129287774-129287796 ATCAAAATGACGTGGGGAGAAGG - Intronic
1032142018 7:129340222-129340244 GTCATAAAGAACAGAGGAAAAGG - Intronic
1032432720 7:131874927-131874949 TTCAACAAGAAGTGAGGAAGAGG + Intergenic
1033574740 7:142669945-142669967 GTTAAGAAGAAATGGGGGAAAGG + Intergenic
1033603946 7:142911432-142911454 GTTAAAAGGAAGGAGGGAAAAGG - Intronic
1033711053 7:143945277-143945299 GTTAAAAAGCAGTGGTGAGAGGG + Intergenic
1034211823 7:149370437-149370459 GTCACCAATCAGTGGGGAAAGGG - Intergenic
1034397080 7:150835293-150835315 GTTAGAAAGGAGTGGGGAGATGG + Intronic
1035991159 8:4491559-4491581 GTTTAAAAAAAGTGGGCAAAAGG + Intronic
1036161161 8:6389785-6389807 GTAAAAAAGATAAGGGGAAAGGG - Intergenic
1036515152 8:9437029-9437051 GTCACACAGAAGTGGGAGAAGGG - Intergenic
1037177847 8:15967716-15967738 GTCAGAAAGAAGTGGCAGAAAGG - Intergenic
1037364497 8:18107642-18107664 GACAAAGAAATGTGGGGAAAAGG - Intergenic
1037512445 8:19597695-19597717 GTTAAAAGGAAGTAGGGGAAAGG + Intronic
1038069170 8:23994343-23994365 GGCAAAAAGAGGAGGGGCAAAGG - Intergenic
1039773702 8:40715126-40715148 GCCAGAAAGAAGTGAGGAACTGG + Intronic
1039780562 8:40780985-40781007 GTCAAATGGAAGTGGCAAAAGGG - Intronic
1040023362 8:42760046-42760068 AGCAATAAGAAGTTGGGAAAAGG + Intronic
1040279463 8:46031491-46031513 GACAGAAAGAGGAGGGGAAAGGG + Intergenic
1040560034 8:48515497-48515519 GTTTAAATGAAGGGGGGAAAAGG - Intergenic
1041160855 8:55042399-55042421 GTTGAACAGAAGTGGTGAAAGGG - Intergenic
1041789425 8:61676370-61676392 GGAAAAAAGAAGTGGAGGAAGGG + Intronic
1042027859 8:64443190-64443212 GCCAAAAGGAAGTGGGGCAGCGG + Intergenic
1042393937 8:68268863-68268885 ATACAAAAGAAGTTGGGAAACGG - Intergenic
1043158606 8:76817853-76817875 ATCAGAATGAAGTGGAGAAAAGG + Intronic
1043196239 8:77295831-77295853 GTCACAACTAAGTGAGGAAAGGG + Intergenic
1043459465 8:80444998-80445020 GTCAGAAGGGAGTGGGGAAATGG + Intergenic
1043577357 8:81673375-81673397 GACAACTAGAAGTGGGGAAGGGG - Intronic
1043729735 8:83661292-83661314 GTAAAAAAGAACTGTAGAAAAGG + Intergenic
1043870827 8:85429859-85429881 GACAAGAACCAGTGGGGAAATGG - Intronic
1044170618 8:89047215-89047237 GTCAAAAGGTTGTGGAGAAAAGG - Intergenic
1044309140 8:90673113-90673135 GACAAGTAGAAGAGGGGAAAAGG + Intronic
1044413540 8:91910893-91910915 TTCAGAAAGGAGTGGGGCAAAGG + Intergenic
1044475459 8:92619922-92619944 GTCACAAAGATGAGGGAAAATGG - Intergenic
1044542762 8:93426266-93426288 GTCAAGAAGAAGCGGAGGAAGGG - Intergenic
1044561196 8:93613831-93613853 TTGAAAAACAAGAGGGGAAAAGG + Intergenic
1045445685 8:102260893-102260915 GGCAAACAAAAGTGTGGAAAGGG - Intronic
1046254924 8:111683304-111683326 GTAAAAGAGAAGTGAGGAATGGG + Intergenic
1046394324 8:113620749-113620771 GTCAAAAAGAAGTGCTGTAAAGG - Intergenic
1046920216 8:119719829-119719851 GGCAATAAGAAGTGGACAAATGG + Intergenic
1047086340 8:121520485-121520507 GTTAAAAAGGAGTGGTGAGAGGG - Intergenic
1047395442 8:124493872-124493894 ACCAAAAAGAAGTGGGAAAGTGG - Exonic
1047620720 8:126603833-126603855 GAGAAAAAGGAGTAGGGAAAAGG + Intergenic
1049667965 8:143856503-143856525 TTCAAAAACAAGTGGAGGAAAGG - Intergenic
1050918453 9:11167459-11167481 GTCAAAATGATAAGGGGAAAAGG - Intergenic
1051116612 9:13701377-13701399 GTTGAAAAGCAGTGGTGAAAGGG + Intergenic
1052128300 9:24807442-24807464 GACAAAAAGAAATGGGTAAAAGG + Intergenic
1052301234 9:26954975-26954997 ATGAAAAAGAAATGGGGACAGGG + Intronic
1052783699 9:32808457-32808479 GTTGAAAAGAAGTGGTGAGAGGG - Intergenic
1052793921 9:32904586-32904608 GGCAATGAGAATTGGGGAAAGGG - Intergenic
1052887207 9:33661375-33661397 GTTAAGAAGAAATGGGGGAAAGG + Intergenic
1054841407 9:69745085-69745107 GTCAAAAAGCTGTGGAGAAATGG - Intronic
1054969792 9:71071954-71071976 GTAAAAAAGAAATGGGTAAGAGG + Intronic
1055537431 9:77263407-77263429 GTCATTAAAAAGTTGGGAAAAGG - Intronic
1055879968 9:80989212-80989234 GTAAGAAAGAAGTAGGGCAAAGG - Intergenic
1057886674 9:98834879-98834901 GCCAAGAAGAAGAAGGGAAATGG - Intronic
1058190696 9:101911720-101911742 GGGAAAGAGAAGTGGGGTAAAGG - Intergenic
1058418592 9:104813981-104814003 TCCAAAGAGAAGTGAGGAAATGG - Intronic
1058502309 9:105633119-105633141 TTGAAAAATAATTGGGGAAAAGG + Intronic
1058629356 9:106970577-106970599 TTCAAAAAGCAGGGGGGAAAGGG - Intronic
1059112487 9:111570329-111570351 ATCAGAAAGGAGTGAGGAAATGG - Intronic
1059692188 9:116696509-116696531 GGAAGAAAGAAGTGGGCAAAAGG - Intronic
1060192385 9:121601152-121601174 GTCTAAAAGGGGTGGGGAAAGGG - Intronic
1060385575 9:123224722-123224744 GTCAAAAAGAAGTGACCAATTGG + Intronic
1060389465 9:123267109-123267131 GGCAAAAGGGGGTGGGGAAAGGG - Intronic
1060699573 9:125739050-125739072 GGGAAAAGGAGGTGGGGAAAAGG + Intergenic
1060712102 9:125877326-125877348 GTCTAAAACAAGTGGGGTACAGG - Intronic
1062140406 9:134954490-134954512 GTTGAATAGAAGTGGGGAGAAGG + Intergenic
1185714009 X:2326765-2326787 GTCAAAGTGAACTGGGGGAAGGG + Intronic
1185914922 X:4025202-4025224 GTAACAAAGATGTGGAGAAAAGG + Intergenic
1186123221 X:6384932-6384954 CATAAAGAGAAGTGGGGAAAGGG + Intergenic
1187043341 X:15620152-15620174 GCCATAAAGAAGTAAGGAAAGGG - Intergenic
1187278330 X:17836120-17836142 TCCAAAAAGATGTGAGGAAATGG - Intronic
1187299400 X:18033133-18033155 GGCAAAAAGATATGGGGAAGAGG - Intergenic
1187426475 X:19181801-19181823 GCCAAAAAGAGATGGGGAAATGG + Intergenic
1188163989 X:26838697-26838719 CTCATTAAAAAGTGGGGAAAAGG - Intergenic
1188416745 X:29944655-29944677 GTAAAAGAGAAGAAGGGAAATGG - Intronic
1188866401 X:35318316-35318338 GTCAAAGAGAAATGGAGAAATGG - Intergenic
1189439925 X:41026188-41026210 GGCAAAAAGAAGGGGGAGAAGGG + Intergenic
1189824460 X:44902888-44902910 GACAAAAAGCAGTAGGGCAAAGG + Intronic
1189987823 X:46569833-46569855 GTCAAAGAGAAGTGGCCACATGG - Intergenic
1190461197 X:50677591-50677613 GTGAAAAAGAGGTGAGAAAATGG + Intronic
1191130963 X:57010179-57010201 GTCAAAAAGTGGTGGGGTAGGGG - Intergenic
1191209923 X:57873879-57873901 GTTAAATAGAAGTGGTGAGAAGG - Intergenic
1191627434 X:63283914-63283936 GTCAAAGAGCAGAGGGGGAAAGG - Intergenic
1192211488 X:69130744-69130766 GTCACAAAGGAGGGGGGAAAGGG - Intergenic
1192695839 X:73415180-73415202 GGCAAAAACAAGTGAGTAAAAGG - Intergenic
1193569509 X:83125416-83125438 GAGGAAGAGAAGTGGGGAAAGGG + Intergenic
1193678477 X:84486112-84486134 ATCCAAAAGAAGTTGGAAAAAGG - Intronic
1193928138 X:87516389-87516411 TACAAAAACAAGAGGGGAAAGGG + Intergenic
1194349858 X:92812841-92812863 GTGAAAAAGAATTTGGAAAAGGG + Intergenic
1194389092 X:93293922-93293944 GGAAAAACAAAGTGGGGAAAGGG + Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1194978251 X:100414208-100414230 GGCAAAGAGAAGGGGGCAAAAGG - Intergenic
1195209905 X:102644837-102644859 GTAGAAAAGCAGTGGTGAAAGGG + Intergenic
1195256442 X:103095523-103095545 GTCAAAATGATATAGGGAAAAGG - Intergenic
1195397887 X:104430600-104430622 GTCAAAAAGGCTTGGGAAAAAGG + Intergenic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1196049648 X:111291274-111291296 GACTAAAAGAAATGGGGAAATGG - Intergenic
1196130040 X:112145690-112145712 GACGAAAAGAAGTGGGGCAATGG + Intergenic
1196648261 X:118141224-118141246 GTCAAAAAGAAAGGGGGAAAAGG + Intergenic
1196994599 X:121368022-121368044 ATCAAAAATGAGGGGGGAAAAGG + Intergenic
1199075403 X:143520071-143520093 CTCAAAAACAAGAGGTGAAAAGG - Intergenic
1200658179 Y:5929469-5929491 GTGAAAAAGAATTTGGAAAAGGG + Intergenic
1201253861 Y:12088163-12088185 GAGAATAAGAAGGGGGGAAATGG - Intergenic
1202385816 Y:24325512-24325534 GACAGAAAGAAGTGGGAGAAAGG - Intergenic
1202484970 Y:25344616-25344638 GACAGAAAGAAGTGGGAGAAAGG + Intergenic