ID: 1195637634

View in Genome Browser
Species Human (GRCh38)
Location X:107135493-107135515
Sequence CAGGGTAATCTCACAGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195637634_1195637640 23 Left 1195637634 X:107135493-107135515 CCTGATACTGTGAGATTACCCTG 0: 1
1: 1
2: 0
3: 9
4: 121
Right 1195637640 X:107135539-107135561 TAAAACCTTTTCTTTCTCCCTGG 0: 1
1: 0
2: 3
3: 37
4: 521
1195637634_1195637637 -5 Left 1195637634 X:107135493-107135515 CCTGATACTGTGAGATTACCCTG 0: 1
1: 1
2: 0
3: 9
4: 121
Right 1195637637 X:107135511-107135533 CCCTGGACTGCTATGAGTAAAGG 0: 1
1: 2
2: 1
3: 4
4: 82
1195637634_1195637639 -4 Left 1195637634 X:107135493-107135515 CCTGATACTGTGAGATTACCCTG 0: 1
1: 1
2: 0
3: 9
4: 121
Right 1195637639 X:107135512-107135534 CCTGGACTGCTATGAGTAAAGGG 0: 1
1: 1
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195637634 Original CRISPR CAGGGTAATCTCACAGTATC AGG (reversed) Intronic
900774652 1:4573523-4573545 CTTGGTAATCTCACAGTGTTAGG - Intergenic
900884170 1:5403678-5403700 CAGGGGAATCTCCCAGGGTCTGG + Intergenic
904994143 1:34617874-34617896 CTGGGAAATGTCACAGTATGAGG + Intergenic
906293869 1:44637109-44637131 CTGGGGAATCTCACAGCAGCTGG + Intronic
914913516 1:151804577-151804599 CAGGGGAAACTCACAGGAGCAGG - Intronic
916863812 1:168834569-168834591 AAGGGTATTCTCACAGTAACTGG + Intergenic
1063843201 10:10094754-10094776 GAGGGTAAACTCAAAGTTTCAGG + Intergenic
1066486193 10:35847338-35847360 CAGGGTCAAGTCACAGAATCAGG - Intergenic
1070915728 10:80153484-80153506 CAAGGTAATGTCACAGAATATGG + Exonic
1073792331 10:106953194-106953216 CATGGTCATCTCTCAGTACCTGG + Intronic
1074172682 10:110958783-110958805 CAGGGTAATGTCTGAGTAGCCGG - Intronic
1078485632 11:11720808-11720830 CAGGATAATCTCTCTGTCTCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1082295649 11:50438854-50438876 CAGGGGAAGCTCACAGGACCAGG - Intergenic
1083025327 11:59545972-59545994 CAAGGTAATCGCTCAGTGTCTGG + Intergenic
1084987072 11:72884413-72884435 CAGTGAAACCTCACAGTAACAGG + Intronic
1086669958 11:89534227-89534249 AAGGCCAATCTCAAAGTATCAGG - Intergenic
1091145792 11:133279030-133279052 CTGGGTGATTTCACAGAATCAGG + Intronic
1093386883 12:18568090-18568112 TAGGATAATCTCACCGTCTCAGG + Intronic
1095416493 12:41982788-41982810 AAAGGTAATCTCACAATATGTGG + Intergenic
1095743666 12:45633879-45633901 CTGGGAAATCTCTCAGTCTCAGG + Intergenic
1096104424 12:48988305-48988327 CAGGGTCATCTCTCAGGAGCAGG + Intergenic
1096918423 12:55058085-55058107 GAGGGAAATATCACAGTATTGGG - Intergenic
1097826434 12:64179124-64179146 CATGGTCATCGCACAGTATATGG - Intergenic
1099175722 12:79419392-79419414 AGTGGTAAGCTCACAGTATCCGG + Intronic
1099668645 12:85661904-85661926 AAGGGAAAACTCACATTATCTGG + Intergenic
1099880060 12:88456916-88456938 CAGGATAATCTCTCCATATCAGG + Intergenic
1101905919 12:108826457-108826479 CAGGGTGATCTCACAGCTTCGGG - Intronic
1110447152 13:75598573-75598595 GAGGATAATCTCAAAGTAACTGG - Intronic
1111323430 13:86660879-86660901 CAGAGTAACCTCAAAATATCTGG + Intergenic
1118259908 14:64236810-64236832 CAGGGCACTGTCAGAGTATCAGG - Intronic
1124572246 15:30875115-30875137 AAGGTTAAAATCACAGTATCTGG - Intergenic
1126899994 15:53305071-53305093 CAGGGTAATCAGACATCATCTGG + Intergenic
1127317938 15:57815269-57815291 CACGGGAAAATCACAGTATCTGG + Intergenic
1128598780 15:68977404-68977426 CAGGGTAAGATCACAGGACCGGG + Intronic
1131245587 15:90789404-90789426 CAGGTGCATCTCCCAGTATCAGG - Intronic
1131867111 15:96722892-96722914 CAGGGGAACCTCACAACATCAGG - Intergenic
1134238461 16:12486282-12486304 CAGGGTAATGTCCCTGTGTCAGG + Intronic
1139398316 16:66658766-66658788 CAGGGATATTTGACAGTATCTGG - Intronic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1145868907 17:28257814-28257836 CAGAGCTATCTCACAGTTTCTGG - Intergenic
1146594409 17:34156655-34156677 CAGGATAAACTCACAGCATCTGG - Intronic
1156367119 18:36439708-36439730 CAGTGTAACCTCTCAGTATGAGG + Intronic
1159460858 18:68721083-68721105 AAGAGCAATCTCACAGTCTCTGG - Intronic
1163284982 19:16340920-16340942 CAGTGGAATCTCACACTATGTGG - Intergenic
1166575826 19:43836813-43836835 CTGAGTTATCTCACAGTATCCGG + Intronic
1167433595 19:49466337-49466359 CTGGGTTATCTCACAGCCTCTGG - Intronic
931562231 2:63574082-63574104 CAGGGTAAGATCACAGGACCAGG - Intronic
938227426 2:129627905-129627927 TAGGTTCATCTCACAGTAGCAGG - Intergenic
939143245 2:138379801-138379823 CAGGACAATCCCACAGAATCAGG + Intergenic
940649562 2:156428035-156428057 CAGGGTAATCTCTCCATTTCAGG + Intergenic
942999440 2:182306830-182306852 CAGTGTAGTTTCACAGTTTCGGG - Intronic
943516185 2:188890241-188890263 CAGGAGACTCTCACATTATCTGG - Intergenic
944244054 2:197514037-197514059 CAGGGAAATATCACACAATCTGG + Intronic
946995798 2:225389657-225389679 CAGGGTAATATGACAGTGACTGG + Intergenic
947183633 2:227434806-227434828 CAGTGTAATGTCACAGTGTGTGG - Intergenic
1169111144 20:3034921-3034943 CATGGTAGGCTCTCAGTATCTGG - Intronic
1170807269 20:19643293-19643315 AAGGGGACTTTCACAGTATCAGG - Intronic
1171513458 20:25706877-25706899 CATGGAAAAATCACAGTATCTGG + Intergenic
1171565321 20:26179161-26179183 CGGGGAAATCTTACAGTATCAGG + Intergenic
1173578420 20:44128827-44128849 CAGGGGCATGTCACAGTACCCGG + Intronic
1174380865 20:50154509-50154531 CAGGGTGATGTCACAGTGACTGG - Intergenic
1178233049 21:30809398-30809420 CAGGGTAATCTCATAGTCGTAGG - Intergenic
950567747 3:13781013-13781035 CAGGGGAATCTCTCAGTGGCTGG + Intergenic
950826793 3:15831545-15831567 CAGGGGAATTTGACAGTGTCTGG - Intronic
951815990 3:26755581-26755603 CAAGATAATCTCCCTGTATCAGG + Intergenic
957509848 3:81173482-81173504 CAGGGTGACCACAAAGTATCTGG + Intergenic
957782236 3:84834506-84834528 CAGGGTAATCAGACATCATCTGG + Intergenic
957825498 3:85437198-85437220 CTGGGTAATGTCTCATTATCTGG + Intronic
958069413 3:88590654-88590676 AAGGGAAATCTCACATCATCTGG - Intergenic
965802605 3:172510243-172510265 CAGGCTAATCTCAAACTCTCAGG - Intronic
970044264 4:11832307-11832329 CAGGGTGATCTGAGAGTAACTGG + Intergenic
972435927 4:39035362-39035384 CAGGGACATCTGACAATATCTGG - Intergenic
973688671 4:53402339-53402361 CAGAGAAATGTGACAGTATCTGG + Intronic
976287090 4:83381304-83381326 CAGGGTAATCAGACATCATCTGG - Intergenic
976803111 4:89015239-89015261 CAGGGTAAGATCACAGGACCGGG - Intronic
977684925 4:99836796-99836818 CTGGATTATCTCACAGTTTCTGG + Intronic
979671281 4:123362792-123362814 TAGGGTACTCTGACAGTTTCTGG + Intergenic
980871753 4:138619799-138619821 CAAGGTAAACTCACAATGTCTGG + Intergenic
981448380 4:144867065-144867087 CAGGGTGATATCACAGGACCGGG - Intergenic
982950405 4:161687719-161687741 CAGAGTGATCTCTCAGTATTTGG + Intronic
985231932 4:187827818-187827840 CAGGGCAATCACACATCATCTGG - Intergenic
986249866 5:6045852-6045874 AAGGACAGTCTCACAGTATCTGG - Intergenic
990183826 5:53191506-53191528 CATGGGAATATCACAGTATCTGG + Intergenic
992218616 5:74549528-74549550 TAGAGTAATCTCTCAGCATCTGG + Intergenic
992923757 5:81558130-81558152 CAGGGTACTGTAACAGTATATGG - Intronic
994923524 5:106083296-106083318 AAGGGTTATCCTACAGTATCAGG + Intergenic
997373017 5:133374098-133374120 AAGGGTGATTTCACAGGATCTGG + Intronic
1001994669 5:176146711-176146733 CAGGGAACCCTCACAGTCTCAGG + Intergenic
1004450225 6:15738637-15738659 CAGGGTGATCACACATTACCTGG - Intergenic
1005366356 6:25082172-25082194 CAGGGTTATGTCATAGTATAAGG - Intergenic
1007506109 6:42336718-42336740 CAGGGAAAACTCACAGCACCCGG + Intronic
1008046007 6:46851878-46851900 CAAGGAAAGCACACAGTATCAGG - Intergenic
1008626268 6:53319886-53319908 CAGAGTACTCTCATATTATCTGG + Intronic
1011034024 6:82953945-82953967 CAGAGTATTCTCCCAGTAGCAGG + Intronic
1013525699 6:110971860-110971882 CTGGGTAATCTCACAGTATCAGG - Intergenic
1014800937 6:125777350-125777372 CAGGGTTAATTCACAGTCTCTGG + Intergenic
1014947202 6:127513634-127513656 CAGGATAATCTCAAAATATGAGG - Intronic
1015620857 6:135130214-135130236 CAGGCCACTCTCACAGTATAGGG + Intergenic
1018087201 6:160313770-160313792 CAGAATAATCTCCCAGTACCTGG - Intergenic
1018455161 6:163945159-163945181 CAGGGTATTGTCCCAGTCTCAGG + Intergenic
1022257564 7:28674465-28674487 CAGGATACTCTCACAGTAAGAGG - Intronic
1022349571 7:29554927-29554949 CAGGGCAGTCTCACATAATCTGG - Intergenic
1023515038 7:40993363-40993385 CAGGGTAAGCAGACAGCATCAGG - Intergenic
1024324940 7:48102101-48102123 CAGGGTGAGCCCACAGTAGCTGG + Intronic
1026459664 7:70602552-70602574 CAGGGTGATCTCATAGCATTTGG - Intronic
1027891614 7:83984320-83984342 CAGTGTAAGATAACAGTATCAGG + Intronic
1032543330 7:132722369-132722391 CAGGGTAATCTCACAGAACAGGG + Intronic
1032674789 7:134119566-134119588 AAGGGTAATCTCACAGTAAAAGG - Intergenic
1039285620 8:36037492-36037514 CCAGGTGATCTCACACTATCTGG - Intergenic
1042175602 8:66034711-66034733 CAGGGTCATCTCAAAGAATATGG + Intronic
1044589329 8:93898552-93898574 CTGGGTCAGCTCTCAGTATCTGG - Intronic
1045142800 8:99305514-99305536 CACAGTAATCCCTCAGTATCTGG - Intronic
1045678062 8:104630005-104630027 CAGTGTAATCTTACAGTTTATGG + Intronic
1048301539 8:133254869-133254891 CAGGGTAAGCTAGCAGTAGCTGG - Intronic
1049156351 8:141069178-141069200 CAGGGTAATCTCTCCATCTCAGG + Intergenic
1049728209 8:144161214-144161236 CAGGATAATCTCCCTGTCTCAGG + Intronic
1053651382 9:40173434-40173456 CAAGGAAAGCACACAGTATCAGG + Intergenic
1054533198 9:66202769-66202791 CAAGGAAAGCACACAGTATCAGG - Intergenic
1055086392 9:72318303-72318325 CAGGATAATCTTCCTGTATCAGG - Intergenic
1186261537 X:7785291-7785313 TGGGGTAGTCTCACAATATCTGG - Intergenic
1188168328 X:26890645-26890667 CAGAGTATTTTCACAGTATAGGG + Intergenic
1188474852 X:30580814-30580836 CAGTGTAATCTTACAAAATCAGG + Intergenic
1188633192 X:32394291-32394313 CATGGTGCTCTCAGAGTATCAGG + Intronic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1193906804 X:87254083-87254105 CATGGTAAAAGCACAGTATCTGG + Intergenic
1194573839 X:95586687-95586709 CAGGGCTGTCTCACAGTATCAGG - Intergenic
1195637634 X:107135493-107135515 CAGGGTAATCTCACAGTATCAGG - Intronic
1196971946 X:121119300-121119322 CAGAGTAATCTCACTGCATTTGG - Intergenic
1198967536 X:142243981-142244003 CAGGGTGACCTCACAGCCTCAGG + Intergenic
1200755868 Y:6989446-6989468 AAGGGACATCTCACAGTGTCTGG + Intronic