ID: 1195638696

View in Genome Browser
Species Human (GRCh38)
Location X:107149812-107149834
Sequence CTGTGGCAGTAGTAGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195638696_1195638703 -5 Left 1195638696 X:107149812-107149834 CCCTCTTACTACTACTGCCACAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1195638703 X:107149830-107149852 CACAGAGTGGGAGCGGGAAAAGG 0: 1
1: 0
2: 0
3: 47
4: 399
1195638696_1195638707 26 Left 1195638696 X:107149812-107149834 CCCTCTTACTACTACTGCCACAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1195638707 X:107149861-107149883 ATTTAGCTGCTAAGACAACAGGG 0: 1
1: 0
2: 2
3: 11
4: 156
1195638696_1195638704 -2 Left 1195638696 X:107149812-107149834 CCCTCTTACTACTACTGCCACAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1195638704 X:107149833-107149855 AGAGTGGGAGCGGGAAAAGGAGG 0: 1
1: 0
2: 4
3: 96
4: 948
1195638696_1195638706 25 Left 1195638696 X:107149812-107149834 CCCTCTTACTACTACTGCCACAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1195638706 X:107149860-107149882 CATTTAGCTGCTAAGACAACAGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195638696 Original CRISPR CTGTGGCAGTAGTAGTAAGA GGG (reversed) Intronic
901249886 1:7770141-7770163 CTCTGGCAGTAGTGGCCAGATGG - Intergenic
902677149 1:18016650-18016672 TTGTGGCAGTAGAAGAAAGGTGG + Intergenic
902695542 1:18138403-18138425 CAGTAGCAGTAGTAGGAATACGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905521812 1:38606021-38606043 CTCTGACAATACTAGTAAGAAGG + Intergenic
905737243 1:40338198-40338220 CTGTGGCTGTAGTGGAAAGTGGG - Intergenic
906254816 1:44340090-44340112 ATGTGGCAGTAATAGGAACATGG + Intronic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
908964315 1:69739450-69739472 GCTTGGCAGTAGTAGAAAGATGG - Intronic
909526221 1:76625789-76625811 CTGTGACAGTAGCAGCAACATGG - Intronic
910164042 1:84304573-84304595 TTGTGGCAGTAGTTTCAAGAGGG - Intronic
912428575 1:109615835-109615857 ATGTGGAAGTAATAGAAAGAAGG - Exonic
913492630 1:119395694-119395716 CTGTGGCATTATGAGTAAAAGGG - Intergenic
918738407 1:188096090-188096112 TAGTGACAGTAGTAATAAGATGG + Intergenic
918833253 1:189425996-189426018 TTGTAGCAATATTAGTAAGAAGG - Intergenic
919012438 1:191983035-191983057 CTGTGATAGTAGTGGTAGGATGG + Intergenic
919303180 1:195796267-195796289 ATGTGGCAGTATCCGTAAGATGG + Intergenic
921882452 1:220270881-220270903 ATGAGGCAGTAGTAGTAATAAGG - Intronic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
923866855 1:237948766-237948788 CTGTTGCTATAGTGGTAAGAAGG + Intergenic
1064285077 10:13984960-13984982 CTGTGGCAGAAATAGTAGGTGGG - Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1067533218 10:47089472-47089494 CTGTGGCAGTCATAGTGAGCTGG + Intergenic
1070115588 10:73525810-73525832 CTGCAGCAGCAGTAGTAAAAAGG - Intronic
1071680829 10:87703743-87703765 CTGGGCCAGTAGTGGGAAGAAGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1076367162 10:129928952-129928974 TTGTGGCAATATTAGTAAAACGG + Intronic
1079814885 11:25043041-25043063 CTGTGGGAATAGTTCTAAGATGG + Intronic
1083880948 11:65547964-65547986 CAGTGGCAGGAGTAGTCAGGGGG + Exonic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088553521 11:111038429-111038451 CTGTGGCAGTGATGATAAGAAGG - Intergenic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1098541154 12:71659231-71659253 CTCTGGCAGCAGCAGTATGAAGG - Intronic
1100221599 12:92510130-92510152 CTTTTGCAGTAGTAGCAATAAGG - Intergenic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106816649 13:33415418-33415440 CAGTGGCAGTAGGAGTAAGAGGG + Intergenic
1109229814 13:59743169-59743191 CTTTGGCAGTGATAGTATGAAGG + Intronic
1109843348 13:67949959-67949981 CTCTAGAAGTAGTAGTATGATGG - Intergenic
1112814524 13:103256330-103256352 CTTTTGCAGTACTAATAAGAGGG + Intergenic
1112958743 13:105094485-105094507 CAGTGGCAGTAGCAATAAGCAGG - Intergenic
1117008114 14:51443104-51443126 CTGAGCCAGTAGTGGCAAGAAGG - Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1121589377 14:95090603-95090625 CTGTGGAAGTAGTAGGAAAGGGG - Exonic
1121989057 14:98537261-98537283 CTGAGGTGGTAGTAGTAGGAGGG - Intergenic
1124658140 15:31524928-31524950 CTGTGGCCTTAGGAGTCAGATGG + Intronic
1126490282 15:49229496-49229518 CTGTGGTAGTAGTAGTACGTTGG + Intronic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127734611 15:61829484-61829506 TTCTGGCATTAGTACTAAGAGGG - Intergenic
1130643915 15:85706811-85706833 CTGTGCCAGTGGTATTAAGGAGG + Intronic
1131294721 15:91136851-91136873 CTTTGGCAGGAGAAGCAAGAGGG + Intronic
1132557240 16:578071-578093 CTGTGGCCGAGGTAGTGAGAGGG + Intronic
1135796098 16:25444375-25444397 CTGTGCCAGTAATAGTACTAAGG + Intergenic
1135971998 16:27079074-27079096 TTGTGGCAGTGGTAGGGAGATGG - Intergenic
1138334523 16:56242172-56242194 CAGTGGTAGTGGTAGTAATAAGG + Intronic
1139004874 16:62558444-62558466 CTGGGGCAGTGGTAGTGACAGGG - Intergenic
1140564533 16:76026616-76026638 CTGTGGCAGATGCAGTAATAGGG + Intergenic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1153834778 18:8954198-8954220 CTCTGGCAGGTATAGTAAGAGGG - Intergenic
1153897913 18:9585114-9585136 ATGATGAAGTAGTAGTAAGATGG - Intronic
1154485062 18:14866613-14866635 CTGTTAGAGTAGTAGAAAGATGG + Intergenic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1160373501 18:78393211-78393233 CTGGTGCAGTACTAGAAAGAAGG - Intergenic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1166641582 19:44498899-44498921 CTGTGGCTGTATCAGTAGGAGGG - Intronic
927313911 2:21660112-21660134 CTGTGGCAGCAGTAGAAAAAGGG + Intergenic
928262099 2:29777265-29777287 CTATGGCAGGAGTAGGAAAAAGG + Intronic
929521387 2:42654917-42654939 CGTTGGCATTAGTAGAAAGAAGG - Intronic
929981424 2:46683783-46683805 CTGTGGCGGTAGCATTCAGAGGG - Intergenic
935884794 2:107604856-107604878 CTGTGGCATTTGAAGCAAGACGG - Intergenic
936442264 2:112564777-112564799 CTATGCCACTAGTATTAAGAAGG - Intronic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
940927038 2:159375583-159375605 TTCTGGCAATAGTTGTAAGATGG + Intronic
945325372 2:208476052-208476074 CTCTGGCAGAAGGAATAAGATGG + Intronic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
946281099 2:218666013-218666035 CAGTGGAAGTAGTGGTAACAGGG + Exonic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1176796267 21:13372862-13372884 CTGTTAGAGTAGTAGAAAGATGG - Intergenic
1177276235 21:18916275-18916297 CTATGGCAGTATTAGTTTGATGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1183199093 22:36373496-36373518 CTTTGTCAGTAGTGGTGAGAAGG - Intronic
950369110 3:12512953-12512975 CTTTCGCAGTACTAATAAGATGG - Intronic
951372158 3:21862768-21862790 CTGTGGCAGCAGATGTAACAGGG - Intronic
952258873 3:31720246-31720268 CTTTGGCAGTAGTAGGAGGAGGG - Intronic
952502063 3:33972730-33972752 GTGTGGCAGGAGTAACAAGAAGG - Intergenic
954369513 3:50162839-50162861 CTGAGGCAGAAGTAGGGAGAGGG + Intronic
955303322 3:57805532-57805554 CAGTGTTAGAAGTAGTAAGAGGG - Intronic
957829491 3:85497396-85497418 CTCTTGCAGTAGCAGAAAGAAGG + Intronic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
962351038 3:134655903-134655925 CAGTGGCAGTAGTAAAAAGTTGG + Intronic
962739126 3:138349755-138349777 GTCTGGCAGCAGAAGTAAGATGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
966638294 3:182159875-182159897 CTCTGGCAAAAGTAGTAATATGG - Intergenic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
969368010 4:6710794-6710816 CTGTGGCACTTGTGTTAAGAAGG - Intergenic
969978064 4:11124842-11124864 TTTTGGCTGAAGTAGTAAGAAGG + Intergenic
970397887 4:15689269-15689291 CTATGGAAAGAGTAGTAAGAAGG + Exonic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977875212 4:102141558-102141580 CTTTGGCAAAAATAGTAAGATGG + Intergenic
980297874 4:130945662-130945684 CTGTGGCAGTATTGTTAAGCAGG + Intergenic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983684797 4:170395663-170395685 CTATGGAACTAGTAATAAGATGG - Intergenic
983917047 4:173303239-173303261 TTGCGGCAGAAGTAGGAAGATGG + Intronic
983955634 4:173695723-173695745 ATGTAGCAGTAGTAGAGAGAAGG - Intergenic
986726869 5:10605004-10605026 CTGTGGCTGTAGTTGTCTGAAGG + Intronic
986745318 5:10738698-10738720 TTGTGGCAGTAGTGGGAAAATGG + Intronic
988114963 5:26874940-26874962 CTGGGGCAGAATTAGTAATAAGG + Intergenic
989521321 5:42404015-42404037 CTGTAGTAGTATTAGTAATATGG - Intergenic
989613925 5:43320700-43320722 CCCTGGGAGAAGTAGTAAGAAGG - Intergenic
990765507 5:59177961-59177983 CTGTGGCAGTAGTCCTGGGAAGG - Intronic
991059602 5:62359598-62359620 ATGAGGCAGGAGTAGAAAGAGGG - Intronic
992309847 5:75485372-75485394 CAGTGAAAGTAGTACTAAGAGGG + Intronic
992366587 5:76097861-76097883 CTCTGGCAGTAGTTGAGAGAGGG + Intronic
993246212 5:85456763-85456785 GAGTGGCAATAGTAGAAAGAAGG - Intergenic
998134533 5:139667839-139667861 CAGTGTCAGTAGTAATAATAAGG - Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004995113 6:21183761-21183783 CAGTGGCAGAAGTAATAATATGG - Intronic
1006841009 6:37027893-37027915 CTGGGGCAGTAGGACTGAGAGGG + Intronic
1007177830 6:39908843-39908865 CTGTGGCAGGTATAGTAAGGGGG + Intronic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1018498396 6:164375050-164375072 TGGTGGAATTAGTAGTAAGAAGG + Intergenic
1019887790 7:3920351-3920373 CTGAGACAGGAGTGGTAAGAGGG + Intronic
1021767144 7:23961337-23961359 CTTTGGCTGGAGTAGGAAGATGG + Intergenic
1022255344 7:28651013-28651035 CATTGGCAGTGGTAGTAAAAGGG + Intronic
1024334652 7:48195172-48195194 ATGTGGCTGAAGTAGTAAGCAGG + Intronic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1029788971 7:102822557-102822579 CTGTGACAGTAATAGAAAGTGGG - Intronic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1031971981 7:128071787-128071809 CTGTGGCAGCTGTAATAAAAGGG + Intronic
1032894404 7:136234828-136234850 CTGTGGCAGGAGTTGAAAGCCGG + Intergenic
1034296568 7:149978104-149978126 CTATGGCAGAAGTGGAAAGAAGG - Intergenic
1034809463 7:154118721-154118743 CTATGGCAGAAGTGGAAAGAAGG + Intronic
1035981852 8:4381368-4381390 CTGTGGCTGTAAGAGTAAGCAGG + Intronic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1043499369 8:80837847-80837869 CTGTGGCAGTGGCAGTCAGGGGG - Intronic
1044276897 8:90311601-90311623 GTCAGGCAGTAGTAGTAAAAAGG + Intergenic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1046820265 8:118627080-118627102 TTTTGGAAGTAGTAGTAAAAGGG - Intergenic
1048122664 8:131599256-131599278 CTGTGGCAGTAGTAGAAACCTGG - Intergenic
1048200788 8:132372410-132372432 CTGGGGGAGTAGTATTAATAAGG - Intronic
1052258466 9:26487303-26487325 CAGTGAAAGTAGTACTAAGAGGG - Intergenic
1054703291 9:68435873-68435895 CTGTGGCAGTAAGAGTGACAAGG - Intronic
1057288779 9:93785586-93785608 AAGTGGAAGTAGTATTAAGAGGG - Intergenic
1057598261 9:96435197-96435219 CTCTGGCAGTTGCAGTCAGATGG + Intergenic
1058924688 9:109651303-109651325 CTGTAGCTGTAGCAGTAGGAAGG - Intronic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1186442687 X:9599676-9599698 CTGTGCCAGAAGTAGTAATATGG - Intronic
1186925084 X:14324789-14324811 TGGTGGCAGCAGCAGTAAGAGGG - Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1193252856 X:79312779-79312801 CAGTGAAAGTAGTACTAAGAGGG + Intergenic
1195638696 X:107149812-107149834 CTGTGGCAGTAGTAGTAAGAGGG - Intronic