ID: 1195640484

View in Genome Browser
Species Human (GRCh38)
Location X:107169413-107169435
Sequence CACTGTTACCTTAAGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195640484_1195640488 27 Left 1195640484 X:107169413-107169435 CCAATTTCCTTAAGGTAACAGTG 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1195640488 X:107169463-107169485 ACAAGACTCCATTTCCTTTTTGG 0: 1
1: 0
2: 4
3: 22
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195640484 Original CRISPR CACTGTTACCTTAAGGAAAT TGG (reversed) Intronic
904505649 1:30950958-30950980 CTCTGTTACCTTGTGTAAATAGG - Intronic
905585567 1:39114879-39114901 AACTGTTACCTAAAGGATGTGGG + Intronic
910347997 1:86263053-86263075 CAATGTTGGCTTAAGCAAATGGG + Intergenic
910999874 1:93152226-93152248 AACTGCTACATTATGGAAATCGG + Exonic
911882621 1:103261019-103261041 CACAGAAACCTTAAGGAATTGGG + Intergenic
912937510 1:114016539-114016561 CTATGTTACCTTAGGGAAGTAGG - Intergenic
917337202 1:173937195-173937217 TACTGTTAACTTAAACAAATGGG - Exonic
919010928 1:191962223-191962245 CACTGTTACCTTACAGGAAAAGG - Intergenic
919247325 1:195004972-195004994 GACAGTTACCTTATGGTAATGGG + Intergenic
923846551 1:237739456-237739478 TACTGTTACCTTATTCAAATTGG - Intronic
923868368 1:237964171-237964193 CACTGTTACCAAACGGAACTGGG + Intergenic
1064786730 10:18905993-18906015 CATTGTTAACTGAAGAAAATGGG - Intergenic
1065038890 10:21670691-21670713 CACTAATACCTTGAGGAAAAGGG - Exonic
1065226908 10:23552928-23552950 CACTGTTATTTTAACTAAATTGG + Intergenic
1065240792 10:23702066-23702088 CACTGTAATCTAATGGAAATTGG - Intronic
1068226314 10:54111254-54111276 CACTATTACCTTTAGTAACTTGG - Intronic
1068494860 10:57774851-57774873 GCCTGTTACCTTAGGGAAATGGG - Intergenic
1068647535 10:59484901-59484923 CATTATTAACTTAAGAAAATTGG + Intergenic
1069176542 10:65296286-65296308 CACTTGTACCTTAAGAAAAATGG + Intergenic
1070502442 10:77084297-77084319 CCATGTTCCCTAAAGGAAATGGG - Intronic
1070743167 10:78915898-78915920 TACTATTACCATAAGGAAAAGGG + Intergenic
1072948033 10:99828074-99828096 CATGGTTACCGTAAGAAAATTGG + Intronic
1073672250 10:105605260-105605282 CATAGTTGCCTTAAGGAAAGTGG + Intergenic
1076242058 10:128915952-128915974 CACCAATTCCTTAAGGAAATGGG - Intergenic
1076653830 10:132008125-132008147 CCCTGGTCCCTTAAGCAAATTGG - Intergenic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1078508911 11:11970971-11970993 CAATGTTAGTTTCAGGAAATAGG + Intronic
1078724750 11:13920051-13920073 CACTGTTACCTTTAGCTAAGTGG + Intergenic
1078820279 11:14873044-14873066 AACTGAAACTTTAAGGAAATAGG + Intergenic
1084714782 11:70866791-70866813 AAATGTTTCCTTAGGGAAATGGG - Intronic
1087182754 11:95156002-95156024 CCCTGTTACCTGAAGGACAGGGG + Intergenic
1087377150 11:97358050-97358072 CACTATAACATTAAGCAAATTGG - Intergenic
1088024982 11:105168647-105168669 AACTGTTACTGGAAGGAAATGGG + Intergenic
1088506639 11:110533617-110533639 CGTTGTTTCCATAAGGAAATTGG - Intergenic
1089398537 11:118151424-118151446 CACAGTGACCTTAATGAAGTGGG - Intronic
1092355317 12:7789793-7789815 CTCTTTTCCCTTAAGGAACTTGG - Intronic
1094675365 12:32614723-32614745 CACTATTAACTGAAGAAAATGGG - Intronic
1095412613 12:41940543-41940565 CATTGATACCCTAAAGAAATAGG + Intergenic
1097412683 12:59274404-59274426 CATTGTTATCTGAAGAAAATGGG + Intergenic
1097583876 12:61492025-61492047 CACTGTTAGTAAAAGGAAATCGG + Intergenic
1101556107 12:105811340-105811362 AACTGTTACCTTTATGAAAAGGG - Intergenic
1104517527 12:129441856-129441878 GGCTGTTACCTTAAGCAAAGTGG + Intronic
1106457617 13:29940946-29940968 AGCTGTTAGCTTAAGGACATTGG - Intergenic
1110663390 13:78085850-78085872 CACGTTCACCTTAAGGAAAAGGG - Intergenic
1110732040 13:78889849-78889871 AACTGTTTCCTAAAGGCAATGGG - Intergenic
1111121664 13:83859586-83859608 GAATGTTACATTAAGGAAATTGG - Intergenic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1113289825 13:108892821-108892843 CTCTATTACCTTATGTAAATTGG + Intronic
1114704054 14:24707748-24707770 CATTGTCACCTTAAATAAATTGG + Intergenic
1116027895 14:39536896-39536918 CACTGTTGCCTTAGGGATATAGG + Intergenic
1116725125 14:48553675-48553697 CAATGTTTCCTTAAGGAACAAGG + Intergenic
1117448582 14:55828652-55828674 CACTATTTCCTTGAGGAAAAGGG - Intergenic
1120165774 14:81197915-81197937 TACTTTTATCTCAAGGAAATGGG - Intronic
1121882184 14:97510694-97510716 CACTGTTTCCCTAAGGATCTGGG + Intergenic
1123391454 15:19877891-19877913 AGCTGTTTCCTAAAGGAAATGGG + Intergenic
1124608338 15:31189376-31189398 AACTTATACCTTAAGGAACTAGG + Intergenic
1124764751 15:32479960-32479982 CCCTGTGACCTTAGGGAAAATGG - Intergenic
1126744477 15:51812248-51812270 CAGTCTTCCCTTAGGGAAATTGG - Exonic
1127002310 15:54523750-54523772 CAGTATTTCCTTCAGGAAATGGG - Intronic
1129020402 15:72512146-72512168 CAGTGTGATCTTATGGAAATTGG + Intronic
1129375563 15:75128373-75128395 TACTGTTTTGTTAAGGAAATTGG - Intergenic
1132072495 15:98790678-98790700 GAGTCTTCCCTTAAGGAAATCGG + Intronic
1135471444 16:22734854-22734876 CACTGTTCCCCCAAGGAAAGCGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138325575 16:56163734-56163756 CATTGTAATCTAAAGGAAATTGG - Intergenic
1144086737 17:11815936-11815958 GTGTGTTACCTTAAGGAATTAGG - Intronic
1145081867 17:19900881-19900903 CACTGTCACCTTTAGGCAAGGGG + Intergenic
1149822850 17:59796605-59796627 CTCTGTTTTCCTAAGGAAATTGG + Intronic
1151988095 17:77556884-77556906 CACGGTTAGCTGAAGGACATTGG - Intergenic
1152484995 17:80584770-80584792 CATTGTTACCATGAGAAAATGGG + Intronic
1154347938 18:13559135-13559157 CACTGTCTCTTTAAGGAAAGAGG + Intronic
1154458386 18:14552073-14552095 CACTTTTACATAAAGGAAGTAGG - Intergenic
1155233378 18:23795372-23795394 CACTATTAGATTAAGTAAATGGG + Intronic
1155867727 18:30987240-30987262 CACATTTACCTTAAGGTATTCGG + Intergenic
1155879668 18:31129463-31129485 TACAGTTACTTTAAGAAAATGGG - Exonic
1158911396 18:62066333-62066355 CACTGTGGCCCTAAGGAGATTGG - Intronic
1159073768 18:63657377-63657399 CAATATTACCTTCAGGAATTAGG + Exonic
1162570849 19:11471753-11471775 GACTGTTACAGTAAGAAAATTGG - Intronic
1164287081 19:23827055-23827077 CATTGTTACTGTAAGCAAATAGG - Exonic
1164545102 19:29154039-29154061 CGCTGTTATCTAAAGGAAAGAGG + Intergenic
1165173884 19:33913217-33913239 CACTGTGACCTTATGAAAAGAGG + Intergenic
1165644247 19:37420286-37420308 CATTGTTATCTTAAGAAATTGGG - Intronic
1166864859 19:45829657-45829679 CACTGTTACCTTCAAAGAATGGG - Intronic
1168231427 19:55034768-55034790 CACTGTAAACATAAGGAAACTGG + Intronic
1168328245 19:55549757-55549779 CACTGTCCCCATCAGGAAATTGG - Intergenic
925733068 2:6936030-6936052 CACTGTTCCTTTAGGGAACTTGG + Intronic
928243993 2:29611536-29611558 AACTCTTACCTTAAGGAAAGAGG + Intronic
928464565 2:31511511-31511533 CACTGTTAGCTGAAGAAAAATGG + Intergenic
929059821 2:37912801-37912823 AACTGTTACCTGAATCAAATAGG - Intergenic
929926133 2:46211446-46211468 TATTCTTACCTTAAGAAAATAGG - Intergenic
930086874 2:47503843-47503865 CACTGGTACCTTGAGGCCATGGG - Intronic
933582990 2:84148392-84148414 TACTGTTACCTTAATGTAGTGGG + Intergenic
938919343 2:135980027-135980049 CTCTGTTTCCTTTAGGATATTGG - Intronic
941688650 2:168474645-168474667 CACTCTTTCTTTAAAGAAATGGG + Intronic
941727813 2:168883026-168883048 CAAAGTTACCCTAGGGAAATAGG + Intronic
941967601 2:171314917-171314939 CACTGTGACCTTATGGAAAGTGG - Intergenic
942338980 2:174922983-174923005 AATTGTTACCTCAAGGAAAGTGG + Intronic
944188894 2:196980193-196980215 CACTGATGCCAAAAGGAAATGGG + Intronic
945625466 2:212199317-212199339 TACTATTACCTTAATGTAATGGG - Intronic
948834369 2:240618686-240618708 AACTGTTACCTGTAGGAAACAGG - Intronic
1170438638 20:16355370-16355392 CACTGATACAATGAGGAAATTGG - Intronic
1170917630 20:20642682-20642704 CCCTCTTATTTTAAGGAAATAGG - Intronic
1172411624 20:34728030-34728052 AACTATTACCTTAGGAAAATGGG - Intronic
1173090083 20:39962141-39962163 CACTGTTACTCTCAGAAAATTGG + Intergenic
1173560229 20:43999809-43999831 TACTGTTGCTTTATGGAAATTGG - Intronic
1176815764 21:13601263-13601285 CACTTTTACATAAAGGAAGTAGG + Intergenic
1177565615 21:22817713-22817735 TTCTGTTACCCTAAGGAAAGTGG - Intergenic
1180514604 22:16129984-16130006 AGCTGTTTCCTAAAGGAAATGGG + Intergenic
1180759401 22:18188107-18188129 CACTGTTTCATTCAGGAACTCGG + Intergenic
1180809346 22:18747628-18747650 CACTGTTTCATTCAGGAACTCGG - Intergenic
1180827648 22:18875363-18875385 CACTGTTTCATTCAGGAACTCGG + Intergenic
1181195341 22:21181550-21181572 CACTGTTTCATTCAGGAACTCGG - Intergenic
1181214107 22:21311224-21311246 CACTGTTTCATTCAGGAACTCGG + Intergenic
1183198318 22:36368640-36368662 CACTGTTATCTTAGAGAAATTGG - Intronic
951972498 3:28462887-28462909 AACTTCTTCCTTAAGGAAATGGG + Intronic
952010936 3:28900598-28900620 CCCTGTAAGCTTAAGGAGATAGG - Intergenic
958872818 3:99581202-99581224 AACTATTACCTGAAGGAAACAGG + Intergenic
959771455 3:110103683-110103705 CACAGTTACATTAAGTAAAAAGG - Intergenic
962732676 3:138298514-138298536 CACACTTACCTTAAGGCACTGGG - Intronic
963627974 3:147697023-147697045 CACTGTGACATTTAGGAATTGGG + Intergenic
964460354 3:156918384-156918406 CAGTGGTACTTTAAGGAAATTGG + Intronic
965676953 3:171207563-171207585 CACTGCCACCTCAAGGAAAACGG - Intronic
966216278 3:177506484-177506506 CTCTGTGACCTTAAGTAAAGTGG - Intergenic
966858626 3:184214731-184214753 AGCTGTTTCCTTGAGGAAATAGG - Intronic
969727394 4:8928944-8928966 CACTTTTACATTAAGAAAAAGGG + Intergenic
970818771 4:20189263-20189285 CTCTCTTACCTTCAAGAAATGGG - Intergenic
976731217 4:88263855-88263877 ATCTGTTTCCTTCAGGAAATAGG - Intronic
977032746 4:91907300-91907322 AACTGATGCCTTAAGGAATTTGG + Intergenic
978295713 4:107202856-107202878 CAATGTTACCTCATGAAAATGGG + Intronic
978536673 4:109770185-109770207 AACTGAAACTTTAAGGAAATGGG + Intronic
979832600 4:125319083-125319105 CTCTATTGCCTGAAGGAAATGGG - Exonic
980381002 4:132016651-132016673 CAATATTATCTTAAGGGAATAGG + Intergenic
981032595 4:140140497-140140519 CACTGTAAGCTTTAGGAAAGGGG - Intronic
981398010 4:144277287-144277309 TAATATTACCTTAAGTAAATGGG - Intergenic
983167096 4:164491118-164491140 CACTGTTAACTGAAGAAAAATGG + Intergenic
983276341 4:165622195-165622217 CATTGTTACCTGGAGGAAACTGG - Intergenic
984558752 4:181243205-181243227 CAATGTTATCTTAAGGAACCAGG - Intergenic
986376584 5:7138028-7138050 CACTGTTACCATAAGAAAAATGG - Intergenic
987004076 5:13691592-13691614 CCCTGTTACCTTCAAGAACTTGG + Exonic
988316772 5:29641374-29641396 CACTATTAACTGAAGGAAAATGG + Intergenic
991000630 5:61779309-61779331 CTCTGTTACATGAAGGAATTCGG + Intergenic
992370906 5:76143202-76143224 CAATTTTTTCTTAAGGAAATTGG + Intronic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
993990128 5:94646247-94646269 CAATGTTACCTTAAAAAAAAGGG - Intronic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
997841442 5:137244336-137244358 CACAGTTACCTTAAAGACAGTGG - Intronic
999870907 5:155750171-155750193 CACTGTTACCTTTAGAATCTGGG + Intergenic
1000437496 5:161230954-161230976 CACTGTGATATTAAGGACATAGG - Intergenic
1003135227 6:3430086-3430108 AAGTGTTATCTTCAGGAAATGGG + Intronic
1004744208 6:18493650-18493672 CACTGTGTCCTGAATGAAATAGG + Intergenic
1008702219 6:54114962-54114984 TTCCGTTACCTTAACGAAATAGG + Intronic
1008918082 6:56811356-56811378 CCCTGCTACCAGAAGGAAATGGG + Intronic
1008957685 6:57233723-57233745 CACTGTAACCTTAAACACATGGG + Intergenic
1011063121 6:83294300-83294322 CTCTGTAACCTTAAGGGAATTGG - Intronic
1013053621 6:106561781-106561803 AACAGTTACATTAAGGAAAAAGG - Intronic
1014009566 6:116460570-116460592 CTCTGCTACCTTAAGAGAATTGG - Intergenic
1019995442 7:4721398-4721420 CACTGTCACCTGCAGGAAACAGG - Intronic
1020258801 7:6518790-6518812 CACTGTGATCTAAAGGAATTTGG + Intronic
1021429624 7:20545880-20545902 CACTGTTTTCTTAAAGAAAATGG - Intergenic
1021649148 7:22816067-22816089 CACTGTTTTCATAAGGAAATGGG + Intronic
1023361245 7:39417696-39417718 CTCTGTTACTCTAAGGAGATTGG - Intronic
1027244293 7:76356329-76356351 TCCTGTGACTTTAAGGAAATAGG - Intronic
1028113075 7:86966275-86966297 CAATGTTTCCTCCAGGAAATTGG - Intronic
1028471320 7:91209717-91209739 AACTGTTATTTTAAGAAAATGGG - Exonic
1029904844 7:104081429-104081451 CATTTTTACCCTAAGAAAATTGG + Intergenic
1030547382 7:110913748-110913770 CACTGTTAACTGAAGAAAAATGG + Intronic
1030591942 7:111492539-111492561 TGCAGTTCCCTTAAGGAAATTGG + Intronic
1031485991 7:122325209-122325231 CACAGTTACCTGAAGGAAGTAGG - Intronic
1032674008 7:134111415-134111437 CACTGTTACTTGAAGGTAAGTGG + Intergenic
1032876370 7:136042804-136042826 CACTATTTCCTTTAGGAAATGGG + Intergenic
1034242668 7:149622308-149622330 CATTTTTACCTTGAGGAGATGGG - Intergenic
1036537968 8:9670549-9670571 CAATGTTATATTAATGAAATTGG + Intronic
1040974498 8:53175067-53175089 GACTGTGACCTTAAGAAAAAGGG + Intergenic
1041119104 8:54568633-54568655 CTCTTTTATCTTAAGGAAGTTGG + Intergenic
1042413390 8:68490974-68490996 TACTGTTACATTAAAGACATAGG - Intronic
1042461601 8:69075123-69075145 AAATGTTAACTTAAGGAATTTGG + Intergenic
1043278778 8:78436673-78436695 CACTGTAACCTTGATGGAATTGG + Intergenic
1044162622 8:88938533-88938555 AAATGTTAACATAAGGAAATGGG - Intergenic
1044452824 8:92358152-92358174 TACTGTTGGCTTAAGGAATTTGG + Intergenic
1044515067 8:93128087-93128109 CACGGCTCACTTAAGGAAATTGG - Intergenic
1044559146 8:93595699-93595721 AACTCTCTCCTTAAGGAAATGGG - Intergenic
1048727836 8:137407144-137407166 ACCTGTTGGCTTAAGGAAATTGG + Intergenic
1052292779 9:26863315-26863337 CAGTATTACCTGAAGTAAATGGG + Intronic
1055733039 9:79298663-79298685 ATCTGTTAACTTATGGAAATGGG - Intergenic
1059569103 9:115415316-115415338 CACTGTTAAGAGAAGGAAATTGG - Intergenic
1060770626 9:126329229-126329251 CACTTTTACATTACAGAAATGGG - Intronic
1203531593 Un_GL000213v1:148198-148220 CACTTTTACATAAAGGAAGTAGG - Intergenic
1185484192 X:469697-469719 CACTGCTTCCTTTCGGAAATTGG + Intergenic
1188588842 X:31809791-31809813 CACTGTAATCTTAAAAAAATAGG + Intronic
1190555689 X:51632845-51632867 CACTATTACTATAAAGAAATAGG + Intergenic
1190643383 X:52502533-52502555 CACTGTCACACTATGGAAATAGG - Intergenic
1192944241 X:75948611-75948633 GACTGATACCTTAAAGAGATGGG - Intergenic
1195640484 X:107169413-107169435 CACTGTTACCTTAAGGAAATTGG - Intronic
1196097006 X:111810882-111810904 CATTATTACCTTATGGCAATAGG + Intronic
1198479074 X:137023893-137023915 CACTGTTTCCTCAAGGATCTTGG + Intergenic