ID: 1195640999

View in Genome Browser
Species Human (GRCh38)
Location X:107174617-107174639
Sequence AAGGGCCAGCTGTAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195640999_1195641008 29 Left 1195640999 X:107174617-107174639 CCCCAAAACTACAGCTGGCCCTT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1195641008 X:107174669-107174691 GTAAGGACCACAAACCAGGTCGG 0: 1
1: 0
2: 1
3: 16
4: 91
1195640999_1195641007 25 Left 1195640999 X:107174617-107174639 CCCCAAAACTACAGCTGGCCCTT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1195641007 X:107174665-107174687 AAATGTAAGGACCACAAACCAGG 0: 1
1: 0
2: 1
3: 10
4: 160
1195640999_1195641006 12 Left 1195640999 X:107174617-107174639 CCCCAAAACTACAGCTGGCCCTT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1195641006 X:107174652-107174674 CTTCTGATAGGTAAAATGTAAGG 0: 1
1: 0
2: 0
3: 16
4: 219
1195640999_1195641004 0 Left 1195640999 X:107174617-107174639 CCCCAAAACTACAGCTGGCCCTT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1195641004 X:107174640-107174662 TGTCATGTTCCACTTCTGATAGG 0: 1
1: 0
2: 4
3: 133
4: 1522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195640999 Original CRISPR AAGGGCCAGCTGTAGTTTTG GGG (reversed) Intronic
900404323 1:2485853-2485875 AAAGGCCAGCTCTGGGTTTGTGG - Intronic
903549065 1:24144934-24144956 AAGGGCATCCTGTAGTTTCGAGG + Intergenic
903647129 1:24902402-24902424 AAGGGCCCGCTCTGGTTCTGCGG + Exonic
904316164 1:29665304-29665326 ATGAGGCAGCTGTAGTTTTCAGG + Intergenic
905247958 1:36627709-36627731 AATGGCCAGCTGCAGTCCTGAGG - Intergenic
906754738 1:48299971-48299993 AAGGATCAACTGTAGTTTTGAGG + Intronic
909992412 1:82239705-82239727 GAGGGACAGCTGCAGTATTGTGG - Intergenic
910429418 1:87146597-87146619 TAGGGCCAGTGGTAGTATTGGGG + Intronic
911494146 1:98610216-98610238 AATGGCAAGCTATAGTCTTGTGG + Intergenic
911734095 1:101318363-101318385 AAGGGAAAACTGTATTTTTGTGG - Intergenic
915638463 1:157203086-157203108 AAGGGTCAGCTGCAGTGTGGAGG - Intergenic
916550924 1:165849238-165849260 AAGGGGGAGTTGTGGTTTTGTGG + Intronic
919549457 1:198966397-198966419 AAGCATCAGCTGTAGTATTGTGG + Intergenic
921448749 1:215277860-215277882 AAGATACAGCTGTAGTTTGGTGG + Intergenic
922455151 1:225768347-225768369 AAGGGCCAGGTGCAGTTTGCTGG + Intergenic
922955613 1:229596715-229596737 AAGAGACAGCTGTAGTTTTGAGG - Intronic
923043015 1:230333189-230333211 AAGAGACTGCTGAAGTTTTGAGG + Intronic
924076751 1:240347298-240347320 AACGTCCAGCTGTAGTTTTCAGG - Intronic
924177381 1:241406022-241406044 AATGGCCAGGTGTATTTATGTGG + Intergenic
1063392352 10:5658896-5658918 AAGGGCCATCGGTGGTTTGGGGG - Intronic
1065404300 10:25346392-25346414 AATGGACACCTGTACTTTTGAGG - Intronic
1075624309 10:123950829-123950851 CAGGGCCAGGTGTGGGTTTGGGG - Intergenic
1080312146 11:30906978-30907000 AATGGCCAGCTCCAGATTTGAGG + Intronic
1080773077 11:35360727-35360749 AAGGTCAAGCTGTTGTTTTGAGG + Intronic
1082567646 11:54700165-54700187 AAGCATCAGCTGTAGTATTGTGG + Intergenic
1083172452 11:60931009-60931031 AAAGCCCAGCTGCAGTTCTGCGG + Intronic
1084883669 11:72189666-72189688 AGGGGACAGCTGTGGTTTAGTGG - Intronic
1089043888 11:115481833-115481855 GAAGGCCAGCTGAAATTTTGAGG - Intronic
1089779960 11:120866715-120866737 AAGGACCAGCTGCAGTCCTGAGG - Intronic
1091095359 11:132816050-132816072 AAGGGCAAGTTGGAGTCTTGAGG + Intronic
1092234395 12:6797185-6797207 AATGGACAGCTGTAGATTAGAGG - Intronic
1094184189 12:27623740-27623762 AAGGTCAAGATGTAGTTTTCTGG + Intronic
1094368637 12:29711535-29711557 TAGTGCCAGCTGCAGTTTTACGG - Intronic
1095443379 12:42260259-42260281 AAGTGCCAGCTGTTTTTCTGAGG + Intronic
1099066078 12:77981246-77981268 AAGGACCACATATAGTTTTGAGG + Intronic
1099276809 12:80586694-80586716 GAGGGCCAACTGTAGTGTTTTGG - Intronic
1102135165 12:110568113-110568135 ATGAAACAGCTGTAGTTTTGGGG + Intronic
1104082567 12:125443301-125443323 GAGGGCCAGTTGTAATTTTCAGG + Intronic
1104803008 12:131567442-131567464 AAGGGCCAGCTGAACACTTGAGG + Intergenic
1107130049 13:36885620-36885642 AAGGGTCAGTTCTAGTTTTCTGG + Intronic
1107360635 13:39614194-39614216 GAAGGCCAGGTGTAGTTTAGAGG + Intergenic
1110649683 13:77928635-77928657 AAAGGCCAGTTGTATTTTTCTGG - Intergenic
1110833691 13:80060580-80060602 AAGGGCTAGCTTAAGTTTTTTGG + Intergenic
1114994266 14:28328333-28328355 AAGGGGAAGCAGTAGATTTGGGG - Intergenic
1115146278 14:30229600-30229622 AAGGACCACCTGTATTTTAGGGG - Intergenic
1115384094 14:32775749-32775771 AAAGGCAAGCTTTAGCTTTGAGG + Intronic
1119070603 14:71579422-71579444 AAGGGTCAGCTGTACTCCTGGGG + Intronic
1122069336 14:99195494-99195516 AAGGGCCAGCCATTGTTTTGGGG - Intronic
1123990508 15:25679917-25679939 ACGTGCCAGCTGAAGTTGTGTGG + Exonic
1124993713 15:34701663-34701685 AAGTGCCAGCTGTTGTCTTCAGG + Intergenic
1127009250 15:54604474-54604496 GAGGGGCAGTTGCAGTTTTGGGG + Intronic
1128377829 15:67089944-67089966 AGTGGCCAGCAGTAGTGTTGGGG + Intronic
1132678706 16:1131016-1131038 AGGGGCCAGATGTAGTGTGGGGG + Intergenic
1133622036 16:7535618-7535640 AAGAACCAACTCTAGTTTTGAGG - Intronic
1134187250 16:12094382-12094404 AAGGCCCAGATGTTGTTTTCAGG - Intronic
1137087901 16:36151389-36151411 TAGGGCCATCTGTAATTTGGAGG - Intergenic
1137432607 16:48430570-48430592 AAGGGCCTTCTGATGTTTTGAGG + Intronic
1138432142 16:56975783-56975805 AGGGGGCAGCTGGAGATTTGAGG - Intronic
1144139644 17:12336394-12336416 AAGCGTCAGCTGTAGTAGTGTGG + Intergenic
1148723473 17:49771875-49771897 CAGGGACAATTGTAGTTTTGAGG - Intronic
1149372811 17:56011876-56011898 ATGGGCCAGCTGTAGAGTGGGGG + Intergenic
1151161409 17:72168790-72168812 AACGACCAGCTCTAGTTTGGGGG - Intergenic
1151572039 17:74931299-74931321 GGGGGCCAGCTGTAGCTTTGGGG + Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1154281517 18:13007334-13007356 ATGGGATAGCTGTCGTTTTGAGG + Intronic
1154373151 18:13784655-13784677 AAGGATCAACTGTAGTTTTACGG - Intergenic
1155188544 18:23409474-23409496 GAGGGCCAGCTGTATATTTAAGG - Intronic
1156494533 18:37517239-37517261 AAGGGCCAGCTTTTGCTTTTGGG + Intronic
1161874993 19:6901472-6901494 TAGGGCCAGCTGTATTTAAGGGG + Intronic
1162804673 19:13131148-13131170 AAGGACCAGCTGTGCTTATGTGG - Intronic
1165639737 19:37374073-37374095 AAGGGGCAGTAGTATTTTTGTGG + Intronic
1167718217 19:51158179-51158201 ATGGGCCAGGTATAGTTCTGGGG - Intergenic
926523025 2:13941514-13941536 AATGGTCAGCTGTTATTTTGGGG + Intergenic
927241260 2:20921141-20921163 AAGGGCAAGCTGTAGCTGTGGGG + Intergenic
929115369 2:38439432-38439454 AAGTGCCAGTTGGAGTGTTGTGG - Intergenic
929558817 2:42942913-42942935 AAGGGCTAGCTGTGGTTTCCAGG - Intergenic
930466726 2:51762153-51762175 CAAGGCCAACTGCAGTTTTGAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934906007 2:98204150-98204172 AAGGGACAACTGTAGTTCTCAGG + Intronic
935406337 2:102713981-102714003 AAGGGTCAACTGTACTTTTAAGG - Intergenic
936066866 2:109339263-109339285 AAGGGTCAGCTGTTTTTTGGGGG + Intronic
942966783 2:181904165-181904187 AAGTGCTAGATGTACTTTTGTGG + Intronic
943382280 2:187166092-187166114 AATGGACAGCAGAAGTTTTGAGG - Intergenic
1168873733 20:1154829-1154851 GAGTGCCAGCTGTGGTTTCGTGG - Intronic
1170201873 20:13752960-13752982 AAGGGGCACCTCTAGTTTTCTGG + Intronic
1170395554 20:15921755-15921777 AAGGGCCAGCAGTTGATCTGGGG + Intronic
1173109569 20:40174106-40174128 AAGGGCCAGCTGTCCTTTGCAGG - Intergenic
1173764531 20:45595628-45595650 GAGGGACAGCTGTGGTATTGTGG - Intergenic
1175425877 20:58866109-58866131 AAGGCTCTGCTGTTGTTTTGGGG - Intronic
1178711718 21:34923042-34923064 AATGACCATCTGTAGTTTTTTGG - Intronic
1184238762 22:43200593-43200615 CAGGGTCAGCTGTAGTTTAACGG + Exonic
950327043 3:12120592-12120614 CATGGCCAGGTGTGGTTTTGGGG + Intronic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952257820 3:31710675-31710697 GAGGACCAGCTGTGGTTTGGAGG + Intronic
954646818 3:52136646-52136668 AAGGGACAGCTGATGGTTTGGGG - Intronic
956928749 3:74018683-74018705 AAGGGCCAGCTGTCGTTGATTGG + Intergenic
958535502 3:95398161-95398183 AAGGGGAGGCTGTAGTTTTATGG + Intergenic
959014799 3:101121535-101121557 AGGGGGCTGCTGTAGTTTGGTGG + Intergenic
960576323 3:119233355-119233377 AAGGTTCAGCTGTATTTTTTAGG - Intronic
960598857 3:119434943-119434965 CAAGGCCAGCTGTATTTTTATGG + Intronic
964062460 3:152539751-152539773 AAATGCCAGTTGTAGTATTGAGG - Intergenic
965673967 3:171175348-171175370 AAGGGCCAGCTACAGTTAGGAGG + Intronic
965837338 3:172866821-172866843 GCGGGCCAGCTGGAGTTTCGGGG + Intergenic
966314278 3:178627935-178627957 AAGAGGCAGCTGTAATTGTGCGG + Intronic
968688433 4:1976939-1976961 AAGGCCCAGCTGCAGAATTGGGG + Intronic
969484508 4:7464646-7464668 TAGGGGCTGCTGTACTTTTGGGG + Intronic
974700784 4:65443127-65443149 AAGGTCCAGCTGTAGTATCCTGG + Intronic
974951002 4:68582750-68582772 AAGCATCAGCTGTAGTATTGTGG - Intronic
975057526 4:69953129-69953151 AAGGGGCAACTGCAGTTTGGAGG + Intergenic
975869803 4:78767349-78767371 AAGTGACAGATGTAGTTCTGAGG + Intergenic
977432732 4:96952710-96952732 AAGGGCCAGCAGTTGGTTGGAGG + Intergenic
978273006 4:106913951-106913973 AAGAGACAGCTGGAGTTTTCTGG - Intergenic
978972360 4:114824479-114824501 ATGGGCCAGCATTATTTTTGAGG + Intergenic
982139653 4:152305451-152305473 GAGGGCCAGCTTTAGTTTCCTGG + Intergenic
982334561 4:154219501-154219523 AAGGGCCATCTGGATTTTTGTGG - Intergenic
986003909 5:3651621-3651643 AATGCATAGCTGTAGTTTTGTGG + Intergenic
986691380 5:10316493-10316515 AAGGGCCAACTCTAGTTGTCTGG - Intergenic
986789631 5:11147100-11147122 AGGTGCCAGATGTTGTTTTGGGG + Intronic
991621067 5:68545778-68545800 ACGGGCCACCTGGAGTGTTGAGG - Intergenic
995224326 5:109687199-109687221 AATGGCCACATGTCGTTTTGGGG + Intergenic
997651798 5:135527333-135527355 AAGAGCCAGGTGTAGTTATGTGG + Intergenic
998212417 5:140209985-140210007 AATGGAGAGATGTAGTTTTGGGG + Intronic
999498014 5:152119249-152119271 AATGAGCAGCTGTTGTTTTGTGG + Intergenic
1003213959 6:4091749-4091771 AAGGGTCAGCTGTAGTCATTTGG - Intronic
1010648585 6:78424291-78424313 GAGGGCCAGTTTTATTTTTGCGG - Intergenic
1011841751 6:91509458-91509480 AAGTGCCACATGTAGCTTTGAGG + Intergenic
1013342063 6:109224549-109224571 CAGGTCCAGCAGTACTTTTGTGG + Intergenic
1013400578 6:109791999-109792021 AAGGACCAACTCTAGCTTTGGGG + Intronic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1017796136 6:157846322-157846344 AAAAGCCAGCTGTAGTTCTGTGG + Intronic
1019096833 6:169588558-169588580 AAGGGTCAGCTGAATTTTTAAGG + Intronic
1020941266 7:14541205-14541227 AAGTGGCAGCTGTAGTATTATGG + Intronic
1021883987 7:25120673-25120695 AAGGGCCAGATGTATTTAAGGGG - Exonic
1022774367 7:33510013-33510035 ATGGGCCAGATGTGTTTTTGTGG + Intronic
1028402586 7:90440360-90440382 AAGGGCCAGCACTTTTTTTGAGG + Intronic
1029422920 7:100480566-100480588 GGGGGCCAGCTGTAGTTTGCTGG + Intergenic
1030732357 7:113005216-113005238 AATGTCCAGCTCTAATTTTGGGG - Intergenic
1032591850 7:133199249-133199271 AGGGGCCACCTGTAGCTGTGAGG - Intergenic
1034849410 7:154479977-154479999 AAGAGCCAGCGGCAGTGTTGAGG - Intronic
1035076380 7:156180314-156180336 AAGGGCCAGATGTATTTGAGAGG + Intergenic
1036616972 8:10395786-10395808 ATGGGACATCTGTAGCTTTGAGG - Intronic
1037627572 8:20621353-20621375 CAGGGCCTGCTGTGGTTATGGGG + Intergenic
1039992557 8:42501910-42501932 AAGTGTCAGCTGTATGTTTGGGG - Intronic
1041891766 8:62877390-62877412 CAGGGTCAGCTGTAGAGTTGAGG + Intronic
1042338126 8:67650322-67650344 AAGGGCCAGCAGTAGGTCAGCGG + Intronic
1043092603 8:75924400-75924422 GAGGGGCAGCTGTGGTATTGTGG + Intergenic
1044531702 8:93315004-93315026 AAGGACCAGCTTTAATTTTCTGG + Intergenic
1045560472 8:103257184-103257206 AAGGGCCTGCTGCTGTGTTGAGG - Intergenic
1046237269 8:111441582-111441604 CAGTGCCAGCTGTAGTTTGCTGG + Intergenic
1046398987 8:113678572-113678594 AATGGCCATCTATAGTTTTTGGG + Intergenic
1046410692 8:113838663-113838685 AAGGACTAGCAGAAGTTTTGGGG - Intergenic
1048294732 8:133206003-133206025 AAGGGCCAGGTGTGGCTTAGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058297422 9:103326633-103326655 AAGGGACAGCTGAAGGTCTGTGG + Intergenic
1058939448 9:109799478-109799500 AGGGGTCACCTTTAGTTTTGGGG + Intronic
1059381914 9:113933637-113933659 AAGGGCCCACTGGAGGTTTGTGG + Intronic
1059650093 9:116308121-116308143 AAGTGCCTGCTGCAGTTCTGAGG - Intronic
1060198947 9:121640676-121640698 AAGGGCCAGTTGGAGAGTTGGGG - Intronic
1062038358 9:134392731-134392753 AAGGGCCAGCCTCAGATTTGCGG + Intronic
1187877950 X:23819680-23819702 AAAGGGCAGCTGGAGTTTTCAGG - Intergenic
1188860657 X:35251659-35251681 GAGGAGCAGCTGTAGTATTGTGG + Intergenic
1190380672 X:49837143-49837165 AAGCTCCAGCTGCAGTTCTGGGG - Intergenic
1190385304 X:49878701-49878723 AAGCTCCAGCTGCAGTTCTGGGG - Intergenic
1190635359 X:52427358-52427380 AAAGGCCAGATGGAGTTGTGAGG + Intergenic
1190639324 X:52467357-52467379 AAAGGCCAGATGGAGTTGTGAGG + Intergenic
1195640999 X:107174617-107174639 AAGGGCCAGCTGTAGTTTTGGGG - Intronic
1197922324 X:131608666-131608688 AAGGGGCTGCTGGGGTTTTGGGG - Intergenic
1200145520 X:153924446-153924468 GAGGGCCAGCCCTAGTTTAGGGG - Intronic
1201742687 Y:17341259-17341281 AAGGGTCAGCTGCATTCTTGGGG + Intergenic