ID: 1195641653

View in Genome Browser
Species Human (GRCh38)
Location X:107182319-107182341
Sequence ACCAAAAATGTCTCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 36, 3: 115, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195641648_1195641653 18 Left 1195641648 X:107182278-107182300 CCCTGGGCTCTGATGCCAGTAGC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG 0: 1
1: 1
2: 36
3: 115
4: 303
1195641651_1195641653 -9 Left 1195641651 X:107182305-107182327 CCCTAGTCTTGACAACCAAAAAT 0: 1
1: 5
2: 70
3: 365
4: 950
Right 1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG 0: 1
1: 1
2: 36
3: 115
4: 303
1195641650_1195641653 3 Left 1195641650 X:107182293-107182315 CCAGTAGCATCTCCCTAGTCTTG 0: 1
1: 0
2: 2
3: 18
4: 161
Right 1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG 0: 1
1: 1
2: 36
3: 115
4: 303
1195641652_1195641653 -10 Left 1195641652 X:107182306-107182328 CCTAGTCTTGACAACCAAAAATG 0: 2
1: 21
2: 269
3: 751
4: 1117
Right 1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG 0: 1
1: 1
2: 36
3: 115
4: 303
1195641649_1195641653 17 Left 1195641649 X:107182279-107182301 CCTGGGCTCTGATGCCAGTAGCA 0: 1
1: 0
2: 0
3: 21
4: 224
Right 1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG 0: 1
1: 1
2: 36
3: 115
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195641653 Original CRISPR ACCAAAAATGTCTCCAGATT TGG Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901185717 1:7371834-7371856 ACCAAAAATGTCCCTGGAGTGGG - Intronic
901777680 1:11571383-11571405 ACCAAAAATGACCCAAGAGTTGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903710647 1:25321358-25321380 AAAAAAAATGTCTACAGAATCGG + Intronic
904219456 1:28953495-28953517 AACACAAATGTGTCCAGATTAGG - Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905747737 1:40433643-40433665 GCCAAAAATTTCTCCAGGTTTGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906877443 1:49554639-49554661 CCCACAAATGTGTCCAGAATTGG + Intronic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
907792075 1:57676710-57676732 AGCAAAAATTTCACCAGAATTGG - Intronic
908208577 1:61876642-61876664 AATCAAAATGTCTCCAGATGTGG + Intronic
909735506 1:78955419-78955441 ACAAAAAATCTCTGCAGCTTGGG - Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915000282 1:152583168-152583190 AAAAAGAATGTCTCCAAATTAGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916345073 1:163779132-163779154 GCCAAAAAATTCTACAGATTTGG + Intergenic
916424100 1:164664374-164664396 ACCAAAACTGTCACCACAATTGG + Intronic
916537075 1:165713601-165713623 ATCAAAAATTTTTCCACATTCGG + Intergenic
916923569 1:169494307-169494329 TCCAAAAATGTCACTGGATTAGG + Intergenic
917340328 1:173970078-173970100 ACCAGAAGTGTTTCAAGATTTGG + Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918940697 1:190992785-190992807 AAGAAAAAAGTCTCCTGATTTGG + Intergenic
920004987 1:202826541-202826563 ACCAAAACTCTCCCCAAATTCGG - Exonic
920555442 1:206900812-206900834 AGAAAAGATGTCTCCAGGTTAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921649168 1:217656401-217656423 ACCAAATGATTCTCCAGATTTGG + Intronic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923081769 1:230664031-230664053 ACAAAAAAATTCTCCAGATGTGG + Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1064444719 10:15383197-15383219 ACAAAAAATTTATCCAGATGTGG + Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1071052309 10:81466023-81466045 AACACAAATTTCTCCAGATGTGG + Intergenic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074838258 10:117322088-117322110 CCCAAAAACATCTCCAGGTTGGG + Intronic
1075247536 10:120836520-120836542 TCCAAACCTGGCTCCAGATTTGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075623596 10:123946180-123946202 GCCAAAGGTTTCTCCAGATTGGG - Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082685124 11:56228951-56228973 TCCAATAATCTCTCCAAATTTGG + Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083224785 11:61278039-61278061 ACAATAAAGGTCTCCACATTTGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086425769 11:86680998-86681020 ACAAAAAATGTTTGCAGAATAGG - Intergenic
1086439887 11:86817995-86818017 ACTAACCATGCCTCCAGATTGGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086536113 11:87848912-87848934 ACTAAAAATGTGGCCACATTGGG - Intergenic
1087823427 11:102737335-102737357 CCCAAGACTGTCTCCAGATGGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088375391 11:109135234-109135256 AGCTAAAGTGTCCCCAGATTAGG + Intergenic
1088615275 11:111620382-111620404 ACCAAAAATTTCTCCATTTTTGG - Exonic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089424912 11:118364880-118364902 GCCAAAAATGTCTTGAGTTTGGG + Intronic
1089442269 11:118527547-118527569 TCCAACAATGTCTCCAAATGGGG - Exonic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089916464 11:122161562-122161584 AACAAATATGTCTTCACATTAGG - Intergenic
1090628819 11:128628365-128628387 TCCTGAAATGTCTCCACATTTGG + Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093788518 12:23219663-23219685 TCCAGAAATGTCTCCGGAATTGG - Intergenic
1093874715 12:24336454-24336476 ACCAAGAATGTTTTGAGATTGGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100394249 12:94170982-94171004 ACCAATTATCTCTTCAGATTTGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101330789 12:103756259-103756281 ACCAAACCTTTCTCCAGATGAGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103319549 12:120083582-120083604 ACCAAAAATGTGTCTACTTTGGG + Intronic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103865310 12:124046918-124046940 ACCAAAAAGGTATTCAGAGTTGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1106870701 13:34016266-34016288 TCCTCAAATTTCTCCAGATTTGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107463182 13:40624731-40624753 ACCAAAAATGATTCCAGGTTGGG - Intronic
1108092332 13:46861871-46861893 ACCAAAACTGACTTCAGTTTGGG - Intronic
1108300816 13:49073896-49073918 ACCAAAAATGTTTCCAATTTGGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1109529687 13:63625666-63625688 TCAAAAAATGTCTCCGGCTTGGG - Intergenic
1110523124 13:76504458-76504480 CTCATAAATGTCTCCAGATGAGG - Intergenic
1110564459 13:76944392-76944414 ACCAAAATTGTTTCCACCTTAGG - Intergenic
1111519490 13:89381725-89381747 ATCACAAATGTCTTCAGGTTAGG - Intergenic
1111775914 13:92661733-92661755 ACCAAAAATGTTTTAATATTTGG - Intronic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1112903756 13:104391840-104391862 AACAAAAATCTCTCTAGGTTTGG - Intergenic
1114328904 14:21616629-21616651 ACAAAAAAATTATCCAGATTTGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115268435 14:31526105-31526127 AATAATAATGTCTCCAGAATTGG + Intronic
1116250851 14:42481565-42481587 AGTAAAAATGTGTCCAGAATTGG + Intergenic
1116276054 14:42833146-42833168 TCCTAAAATGTCTACAAATTTGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117277600 14:54205682-54205704 ACCAACAATGACAGCAGATTTGG - Intergenic
1118139566 14:63065061-63065083 CTTAAAAATGTCTCCAGTTTAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120335377 14:83148270-83148292 AACATAAGTGTGTCCAGATTTGG + Intergenic
1120436889 14:84493676-84493698 TCCAAAACTGTCTCTTGATTGGG - Intergenic
1120493172 14:85202464-85202486 CCCAAAAATGCCTCCAGGTTTGG - Intergenic
1122057244 14:99109621-99109643 AGCCAAAATTTCTCCAAATTTGG - Intergenic
1123960354 15:25392374-25392396 AATACAAATGTCTCTAGATTTGG - Intronic
1124089219 15:26582042-26582064 ACTACACATGTCTCCATATTGGG - Intronic
1124969678 15:34474952-34474974 ACCAAAAATGTTTTAATATTTGG - Intergenic
1125208237 15:37179767-37179789 ACCAAGAAAGGCTCCAGTTTAGG - Intergenic
1126296141 15:47137192-47137214 TCCAAAAATATCTCCAGTTTAGG + Intergenic
1129904386 15:79175932-79175954 ATCAAAAATATCTCCAGGTGTGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132074435 15:98808338-98808360 TTCAAAAATGTTTCCAGCTTTGG + Intronic
1132127862 15:99245356-99245378 ACAAAAAATTTAGCCAGATTTGG + Intronic
1132189608 15:99840514-99840536 ACCAAAAATGTTTTAATATTTGG + Intergenic
1132914520 16:2335960-2335982 CGAAAAAATGTCTCCGGATTTGG - Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133397877 16:5462766-5462788 ACCAAAAAGGACTCCAGAAGAGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133694939 16:8254025-8254047 ATCAAAAATATTTCCAGCTTCGG - Intergenic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135845542 16:25915092-25915114 ACCAATAACGACTCCAGATGTGG + Intronic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1138045331 16:53717307-53717329 AACAAAAATGTTTGCTGATTTGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143370207 17:6434834-6434856 ACCAAAAATGCCCCCTGAATGGG + Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144381525 17:14703337-14703359 AGCTCAAATGTCTCCAGATTGGG - Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1146847465 17:36192137-36192159 TCCAAAAATTTAGCCAGATTTGG + Intronic
1147013696 17:37473113-37473135 AAAAAAAATTTCTCCAGGTTTGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152923790 17:83078805-83078827 ACCTAAACTCTCTGCAGATTTGG - Intergenic
1153699955 18:7682882-7682904 ACTAAAAAAGTATCCAGAGTAGG - Intronic
1153773951 18:8436677-8436699 CCCAAAAATGTCACCTTATTTGG - Intergenic
1155120943 18:22817838-22817860 ACAACAAATGTCTACTGATTTGG + Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1156327964 18:36091563-36091585 AGCAAAAATGTTTCCAATTTTGG + Intergenic
1157095451 18:44682142-44682164 ACCAAAACTATCTGCCGATTTGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157884794 18:51356410-51356432 ACAAAAATTGTATCCATATTGGG + Intergenic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160224257 18:76999834-76999856 ACCAAAAATGTTCACAGTTTTGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161878950 19:6933680-6933702 ACCAAAAATGTCTTCTGGTCGGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162780434 19:13004063-13004085 ACCAAAAATGATTCCAGGTTGGG - Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163333344 19:16655701-16655723 AAAAAGAATGGCTCCAGATTAGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1166907872 19:46126228-46126250 TCTTAAAATGTCTCCACATTTGG + Intergenic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925053483 2:835594-835616 ACCAAAATAGCCTCCAAATTTGG - Intergenic
927599391 2:24427388-24427410 TCCAAAAATGTTTCAAGCTTTGG - Intergenic
928382539 2:30831895-30831917 ACCAGATATTTCTCCAGTTTAGG - Intergenic
928617765 2:33056517-33056539 TGCAAAAATGTGTCCAGATTTGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930535530 2:52641427-52641449 ACTAAAAATGCCTTCAGCTTTGG + Intergenic
930934997 2:56938177-56938199 ACTAAAAATGTCAACAGTTTGGG + Intergenic
932996868 2:76865544-76865566 AAAACAAATGTCTCCAAATTAGG - Intronic
935483636 2:103624641-103624663 ATAAAAACTGTCTACAGATTAGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
939530552 2:143355085-143355107 ACCTAAACTGTCTCCAGTTTTGG + Intronic
939826472 2:147022145-147022167 ACCAAACATTTCTCCAAAATGGG - Intergenic
940112370 2:150169031-150169053 AACAAAAATATCTCCATATGGGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
945396846 2:209328915-209328937 ACGAAAAATGTCTGAACATTTGG - Intergenic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946118408 2:217485178-217485200 ACCAAAAATTTTTCCAAATTTGG + Intronic
946692914 2:222322399-222322421 ACCAAAAATGTCTCTGGTTGAGG + Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173405282 20:42759048-42759070 ACCAGGAATGTATCCTGATTTGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174866215 20:54138494-54138516 AAAAAAAATGTCTACAGTTTAGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175629286 20:60519686-60519708 CCCAAATATGTCTCCAGCCTTGG + Intergenic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1176877121 21:14142382-14142404 AACAAAAATGTCAGCATATTAGG + Intronic
1177964070 21:27705247-27705269 ACCATGAATTTCCCCAGATTTGG + Intergenic
1178454621 21:32736892-32736914 ACAAAAAATCTCCCCAAATTGGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179352896 21:40630276-40630298 AACAAAAATGTTTGCAAATTCGG - Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182934990 22:34212390-34212412 ATCATGAATTTCTCCAGATTAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952221740 3:31330346-31330368 AGTAAAAATGTCTTCAAATTTGG + Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961075031 3:123974197-123974219 CCCAAAAACGTCTCCAAATGTGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961987687 3:131154948-131154970 ACCAAGAATCTTTTCAGATTTGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964338203 3:155679893-155679915 ACCCAAGCTGACTCCAGATTTGG + Intronic
967041076 3:185692685-185692707 AGCAAAAATGTAAGCAGATTTGG - Exonic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967372540 3:188763456-188763478 ACCAGTAATGTCTGCAGCTTTGG + Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969208427 4:5666443-5666465 ACTAAAAATGTAGCCTGATTTGG - Intronic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971197033 4:24479347-24479369 TCCAGAAATATCTCCTGATTGGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
974591820 4:63959295-63959317 ATCAAATATGTCTACATATTAGG - Intergenic
974854888 4:67448955-67448977 ACAAAAAAGGTATACAGATTGGG + Intergenic
975865757 4:78722184-78722206 ACCTGAGATTTCTCCAGATTGGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
979062724 4:116084361-116084383 ACCCAAAATATCTCAAAATTTGG + Intergenic
979350753 4:119642000-119642022 AACCAAAATGTCTACACATTTGG - Intergenic
981689241 4:147488318-147488340 ATCTGGAATGTCTCCAGATTTGG + Intronic
982186845 4:152811151-152811173 AAGAACAATGTCTCCAGAGTGGG - Intronic
982729502 4:158940856-158940878 AGCAAAAATCTCTCCAAGTTTGG + Intronic
982746793 4:159112193-159112215 ACCAATAATGTCTGAGGATTGGG + Intronic
983122224 4:163900582-163900604 ATCAAAAATGTTTACATATTAGG - Intronic
983607512 4:169606647-169606669 ACCACAGATATCTCTAGATTGGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986409444 5:7462620-7462642 ACCAAAAATACCTAAAGATTTGG + Intronic
986494336 5:8327425-8327447 ACCTAAAATGTCTGAAGTTTAGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987040307 5:14055953-14055975 ATGAAAAATGTCTCCAGGTGGGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987296184 5:16554008-16554030 CCCAAAAATGTTTCAAGATTTGG - Intronic
988046750 5:25965791-25965813 AATAAAAATGTCTTCAGAATTGG + Intergenic
988266333 5:28955400-28955422 ACCAAAAATTAATCCAGTTTGGG + Intergenic
988373172 5:30399463-30399485 AGCAAAAATGTCTTCAAAGTAGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990352226 5:54930358-54930380 CCAAAAAATGTCTACAGATTGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992832317 5:80606078-80606100 ACTAAAAATGTTTTCAGATTAGG - Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994043905 5:95286343-95286365 ACCAAAAACCTCTCCATATGGGG - Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994448298 5:99906203-99906225 ACCAGCACTGTCTCCACATTAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996785347 5:127231013-127231035 ACCAAGATAGTGTCCAGATTTGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999588443 5:153117402-153117424 ACAAAAAATGGCTCCAGTATGGG - Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001229069 5:169970303-169970325 ACCAAATAGGTATCCAGGTTTGG - Intronic
1001673927 5:173497007-173497029 ACCAACAGTCTCTCCAGTTTTGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004581654 6:16960246-16960268 CCCTAAAATGTTTGCAGATTTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004669628 6:17783514-17783536 AACAAAAATGTCACCCAATTTGG + Intronic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007866543 6:44976330-44976352 AGCAGAAATGTCTACACATTTGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010915507 6:81613075-81613097 ACCAGAAATGTATACATATTTGG - Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013001443 6:106026828-106026850 AGCAAAAATCTCTCCAGCTGTGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015435878 6:133187449-133187471 AGCTAAAATCTCTCCAGATTTGG + Intergenic
1015817752 6:137228237-137228259 ACCACAAATGACTACAGAATAGG - Intergenic
1019064693 6:169287492-169287514 ACCAGAAATGTCTCAGGTTTGGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020688151 7:11321286-11321308 ACCAAAAATGGTTGCATATTTGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022170222 7:27820308-27820330 ACAAAAAATGTCTGCAGTTTAGG - Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029335137 7:99892423-99892445 TTCAAAAATGTCCCCAGATGTGG - Exonic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032448322 7:132003743-132003765 ACCATAAATGTCTCAAGTGTAGG + Intergenic
1032572123 7:133011572-133011594 ACCTAAAAGGTCTCCAGGTATGG + Intronic
1034139173 7:148800396-148800418 ACCACAAATCTCCCCTGATTCGG - Intronic
1034384312 7:150726005-150726027 TCCAATAGTGTCTCAAGATTTGG + Intronic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1041502228 8:58552070-58552092 ACCAGAAATGTTTCCAATTTTGG - Intergenic
1041764234 8:61401243-61401265 AAGTAAAATGTATCCAGATTGGG - Intronic
1042653576 8:71069950-71069972 TCCAGAAAAGTCTCCAGGTTGGG - Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1043784398 8:84379821-84379843 AGCTAAGATGTTTCCAGATTTGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047482234 8:125295246-125295268 AACACAAAGGTCACCAGATTAGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1049105326 8:140609017-140609039 CCGAAAAATGTCTGCAGATCTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051680395 9:19601565-19601587 AGTAAAAATGTATCCAGAGTTGG - Intronic
1051925601 9:22321134-22321156 ATCAAAACTGTCTGCAGGTTTGG - Intergenic
1052608588 9:30738821-30738843 AGCCAAAATCTCTCCAGAGTCGG - Intergenic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057034084 9:91799238-91799260 ATCAAAAATGTCTTCGGCTTTGG - Intronic
1057454291 9:95193542-95193564 ACTAAAAATGTCTCTAAATGGGG + Intronic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060195180 9:121618886-121618908 ACCAAAATTGGGACCAGATTAGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061220049 9:129245247-129245269 TCCAGAAATGTCTCCAGCTGCGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185808017 X:3078475-3078497 ACAAAAAAAGTCACCAGGTTGGG - Intronic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186281016 X:7993221-7993243 AAAAAAAATGTATCCAGCTTTGG + Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188281120 X:28270863-28270885 ATCAAAAATGTTCCTAGATTAGG - Intergenic
1188604068 X:32006660-32006682 ACCTTGAATGTCACCAGATTTGG + Intronic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189566136 X:42243039-42243061 ACCAAAAATGTCTGCTACTTAGG + Intergenic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1191751030 X:64542915-64542937 ACAAAAAATGTGGCCAGGTTTGG + Intergenic
1192007142 X:67228319-67228341 AGACAAAATGACTCCAGATTTGG - Intergenic
1195275340 X:103275867-103275889 ACCAAAAATGTTACCGGGTTTGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196681502 X:118474528-118474550 GCTGAAAATGTCTCCAGAGTGGG - Intergenic
1198132274 X:133708155-133708177 ACCAAATATGTTTACACATTTGG + Intronic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199272455 X:145899847-145899869 AACAAAAATGTCTTCATTTTGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1201910816 Y:19132058-19132080 CCCAAACATGTATCCAGAGTTGG - Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic