ID: 1195647374

View in Genome Browser
Species Human (GRCh38)
Location X:107247476-107247498
Sequence GACACTGACATGTTCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195647370_1195647374 20 Left 1195647370 X:107247433-107247455 CCCAGTCTCAGATATTCTCTCAT No data
Right 1195647374 X:107247476-107247498 GACACTGACATGTTCCAGGCAGG No data
1195647371_1195647374 19 Left 1195647371 X:107247434-107247456 CCAGTCTCAGATATTCTCTCATA No data
Right 1195647374 X:107247476-107247498 GACACTGACATGTTCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195647374 Original CRISPR GACACTGACATGTTCCAGGC AGG Intergenic
No off target data available for this crispr