ID: 1195649752

View in Genome Browser
Species Human (GRCh38)
Location X:107272611-107272633
Sequence CTACGACTATGACGGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 13}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195649745_1195649752 11 Left 1195649745 X:107272577-107272599 CCAACATGGACCGCGACTCGTAC 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1195649752 X:107272611-107272633 CTACGACTATGACGGCGGGGAGG 0: 1
1: 1
2: 0
3: 1
4: 13
1195649746_1195649752 1 Left 1195649746 X:107272587-107272609 CCGCGACTCGTACCATCACTATT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1195649752 X:107272611-107272633 CTACGACTATGACGGCGGGGAGG 0: 1
1: 1
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195649752 Original CRISPR CTACGACTATGACGGCGGGG AGG Intergenic
905684909 1:39901383-39901405 CTACGACTATGACTGCGGGGAGG - Exonic
1067436920 10:46284846-46284868 CTGCGACTATGCCTGCGGGAGGG + Intergenic
1069111822 10:64456770-64456792 CTACTACTATGCTGGCAGGGGGG - Intergenic
1138629236 16:58280325-58280347 CTATGACTATTACGGTGGGGAGG - Exonic
1160708826 19:541468-541490 CTACTACGAGGACGGCGAGGTGG + Exonic
927651992 2:24918891-24918913 CTCCGACCCTGACCGCGGGGTGG - Exonic
1175784953 20:61706516-61706538 CTACGACGAAGACTCCGGGGAGG + Intronic
961536435 3:127573610-127573632 GTTCGACTCTGCCGGCGGGGTGG - Exonic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
988115377 5:26881510-26881532 CTACAACGATGAAGGCGGCGGGG - Exonic
1004660732 6:17706829-17706851 CGACGACGACGGCGGCGGGGCGG - Exonic
1004660733 6:17706832-17706854 CGACGACGACGACGGCGGCGGGG - Exonic
1019737195 7:2656421-2656443 CTTCTGCTATGACGGCGTGGAGG + Exonic
1049998394 9:1051757-1051779 CGACGAAGATGACGACGGGGTGG + Exonic
1195649752 X:107272611-107272633 CTACGACTATGACGGCGGGGAGG + Intergenic
1196804656 X:119573984-119574006 CCTTGACTATGACGGGGGGGCGG - Intergenic