ID: 1195654754

View in Genome Browser
Species Human (GRCh38)
Location X:107323938-107323960
Sequence ATGGAGCACGAGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195654745_1195654754 17 Left 1195654745 X:107323898-107323920 CCGAGGCGGAGCTGGGCCCAGGG No data
Right 1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG No data
1195654748_1195654754 1 Left 1195654748 X:107323914-107323936 CCCAGGGTGGTGCTGCGCTTGCA No data
Right 1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG No data
1195654749_1195654754 0 Left 1195654749 X:107323915-107323937 CCAGGGTGGTGCTGCGCTTGCAC No data
Right 1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG No data
1195654742_1195654754 19 Left 1195654742 X:107323896-107323918 CCCCGAGGCGGAGCTGGGCCCAG No data
Right 1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG No data
1195654743_1195654754 18 Left 1195654743 X:107323897-107323919 CCCGAGGCGGAGCTGGGCCCAGG No data
Right 1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195654754 Original CRISPR ATGGAGCACGAGAGGCAGGA GGG Intergenic
No off target data available for this crispr