ID: 1195658202

View in Genome Browser
Species Human (GRCh38)
Location X:107353255-107353277
Sequence TTCTCAGGATTTCCCCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195658202_1195658204 8 Left 1195658202 X:107353255-107353277 CCTGGTTGGGGAAATCCTGAGAA No data
Right 1195658204 X:107353286-107353308 TATTTCTCTCTTTAAATTATTGG No data
1195658202_1195658205 30 Left 1195658202 X:107353255-107353277 CCTGGTTGGGGAAATCCTGAGAA No data
Right 1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195658202 Original CRISPR TTCTCAGGATTTCCCCAACC AGG (reversed) Intergenic
No off target data available for this crispr