ID: 1195658203

View in Genome Browser
Species Human (GRCh38)
Location X:107353270-107353292
Sequence AGAAATATATCTCTTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195658203_1195658207 25 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658207 X:107353318-107353340 GTGCTCTGCACGGTGATGGTTGG No data
1195658203_1195658208 26 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658208 X:107353319-107353341 TGCTCTGCACGGTGATGGTTGGG No data
1195658203_1195658205 15 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG No data
1195658203_1195658204 -7 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658204 X:107353286-107353308 TATTTCTCTCTTTAAATTATTGG No data
1195658203_1195658206 21 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658206 X:107353314-107353336 TGATGTGCTCTGCACGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195658203 Original CRISPR AGAAATATATCTCTTTTCTC AGG (reversed) Intergenic
No off target data available for this crispr