ID: 1195658205

View in Genome Browser
Species Human (GRCh38)
Location X:107353308-107353330
Sequence GAAGTGTGATGTGCTCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195658203_1195658205 15 Left 1195658203 X:107353270-107353292 CCTGAGAAAAGAGATATATTTCT No data
Right 1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG No data
1195658202_1195658205 30 Left 1195658202 X:107353255-107353277 CCTGGTTGGGGAAATCCTGAGAA No data
Right 1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195658205 Original CRISPR GAAGTGTGATGTGCTCTGCA CGG Intergenic
No off target data available for this crispr