ID: 1195665676

View in Genome Browser
Species Human (GRCh38)
Location X:107428053-107428075
Sequence ACATGAGTCAGGAATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195665665_1195665676 30 Left 1195665665 X:107428000-107428022 CCTATTCACAGGTCTCACCCACA No data
Right 1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG No data
1195665670_1195665676 12 Left 1195665670 X:107428018-107428040 CCACACGCAAGAGGAGAGGGTTA No data
Right 1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG No data
1195665669_1195665676 13 Left 1195665669 X:107428017-107428039 CCCACACGCAAGAGGAGAGGGTT No data
Right 1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195665676 Original CRISPR ACATGAGTCAGGAATCTTGG GGG Intergenic
No off target data available for this crispr