ID: 1195666031

View in Genome Browser
Species Human (GRCh38)
Location X:107432036-107432058
Sequence GGGGTGTGAAGGAGTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195666028_1195666031 -9 Left 1195666028 X:107432022-107432044 CCATAACTCTATTGGGGGTGTGA No data
Right 1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195666031 Original CRISPR GGGGTGTGAAGGAGTGGAAG TGG Intergenic
No off target data available for this crispr