ID: 1195668349

View in Genome Browser
Species Human (GRCh38)
Location X:107449915-107449937
Sequence CGGCAGCGGCGGCGCAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195668349_1195668358 0 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668358 X:107449938-107449960 CGCCGCTGAGGAGGCGGAGGAGG No data
1195668349_1195668367 27 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668367 X:107449965-107449987 GGAGGAGGAGGAAGAGGAGGAGG 0: 391
1: 2989
2: 6827
3: 13779
4: 23516
1195668349_1195668366 24 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668366 X:107449962-107449984 GGAGGAGGAGGAGGAAGAGGAGG 0: 261
1: 3075
2: 7137
3: 13824
4: 23053
1195668349_1195668355 -6 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668355 X:107449932-107449954 CTGCCGCGCCGCTGAGGAGGCGG No data
1195668349_1195668354 -9 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668354 X:107449929-107449951 CCGCTGCCGCGCCGCTGAGGAGG No data
1195668349_1195668360 3 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668360 X:107449941-107449963 CGCTGAGGAGGCGGAGGAGGAGG No data
1195668349_1195668361 6 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668361 X:107449944-107449966 TGAGGAGGCGGAGGAGGAGGAGG No data
1195668349_1195668365 21 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668365 X:107449959-107449981 GGAGGAGGAGGAGGAGGAAGAGG 0: 236
1: 3079
2: 7171
3: 14263
4: 24048
1195668349_1195668357 -3 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668357 X:107449935-107449957 CCGCGCCGCTGAGGAGGCGGAGG No data
1195668349_1195668363 12 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668363 X:107449950-107449972 GGCGGAGGAGGAGGAGGAGGAGG 0: 19
1: 2129
2: 6110
3: 13087
4: 22049
1195668349_1195668364 15 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668364 X:107449953-107449975 GGAGGAGGAGGAGGAGGAGGAGG 0: 1901
1: 5100
2: 10705
3: 16594
4: 27534
1195668349_1195668362 9 Left 1195668349 X:107449915-107449937 CCGCCGCTGCGCCGCCGCTGCCG No data
Right 1195668362 X:107449947-107449969 GGAGGCGGAGGAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195668349 Original CRISPR CGGCAGCGGCGGCGCAGCGG CGG (reversed) Intergenic
No off target data available for this crispr