ID: 1195671596

View in Genome Browser
Species Human (GRCh38)
Location X:107474582-107474604
Sequence TCATTGGTAGGGGGTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195671585_1195671596 16 Left 1195671585 X:107474543-107474565 CCAGAATTGTCATATAGGAAGAA No data
Right 1195671596 X:107474582-107474604 TCATTGGTAGGGGGTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195671596 Original CRISPR TCATTGGTAGGGGGTTTAGG AGG Intergenic
No off target data available for this crispr