ID: 1195672051

View in Genome Browser
Species Human (GRCh38)
Location X:107477966-107477988
Sequence AGGATCTAGGTGGGTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195672051_1195672057 3 Left 1195672051 X:107477966-107477988 CCTTCAAGACCCACCTAGATCCT No data
Right 1195672057 X:107477992-107478014 CTCCTCCAGGAAGCCTCCTCTGG No data
1195672051_1195672055 -10 Left 1195672051 X:107477966-107477988 CCTTCAAGACCCACCTAGATCCT No data
Right 1195672055 X:107477979-107478001 CCTAGATCCTCATCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195672051 Original CRISPR AGGATCTAGGTGGGTCTTGA AGG (reversed) Intergenic
No off target data available for this crispr