ID: 1195673403

View in Genome Browser
Species Human (GRCh38)
Location X:107487687-107487709
Sequence CAGTTACACCAGAATCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195673393_1195673403 29 Left 1195673393 X:107487635-107487657 CCAGAGTTTCTAAACTTCCACTT No data
Right 1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG No data
1195673397_1195673403 -10 Left 1195673397 X:107487674-107487696 CCCCATCCCACACCAGTTACACC No data
Right 1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG No data
1195673396_1195673403 -5 Left 1195673396 X:107487669-107487691 CCAGGCCCCATCCCACACCAGTT No data
Right 1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG No data
1195673395_1195673403 12 Left 1195673395 X:107487652-107487674 CCACTTGAATATTGATGCCAGGC No data
Right 1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195673403 Original CRISPR CAGTTACACCAGAATCTCTG TGG Intergenic
No off target data available for this crispr