ID: 1195675168

View in Genome Browser
Species Human (GRCh38)
Location X:107502391-107502413
Sequence TGAGGAAACCAGTTGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195675157_1195675168 25 Left 1195675157 X:107502343-107502365 CCCCAGGTGGGCCTGGGGGTCAG No data
Right 1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG No data
1195675161_1195675168 14 Left 1195675161 X:107502354-107502376 CCTGGGGGTCAGTCAGGAACACC No data
Right 1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG No data
1195675159_1195675168 23 Left 1195675159 X:107502345-107502367 CCAGGTGGGCCTGGGGGTCAGTC No data
Right 1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG No data
1195675164_1195675168 -7 Left 1195675164 X:107502375-107502397 CCTGACAGCCCTTGGATGAGGAA No data
Right 1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG No data
1195675158_1195675168 24 Left 1195675158 X:107502344-107502366 CCCAGGTGGGCCTGGGGGTCAGT No data
Right 1195675168 X:107502391-107502413 TGAGGAAACCAGTTGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195675168 Original CRISPR TGAGGAAACCAGTTGTTGCA GGG Intergenic
No off target data available for this crispr