ID: 1195675219

View in Genome Browser
Species Human (GRCh38)
Location X:107502683-107502705
Sequence TGTCAAGGGCTTTTTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195675219_1195675223 -4 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675223 X:107502702-107502724 GACAAATCTTCATAGAGAAATGG No data
1195675219_1195675228 13 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675228 X:107502719-107502741 AAATGGCCTGGGAATGGAGAGGG No data
1195675219_1195675231 30 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675231 X:107502736-107502758 AGAGGGGCATTGAACTAGAATGG No data
1195675219_1195675229 14 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675229 X:107502720-107502742 AATGGCCTGGGAATGGAGAGGGG No data
1195675219_1195675225 2 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675225 X:107502708-107502730 TCTTCATAGAGAAATGGCCTGGG No data
1195675219_1195675224 1 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675224 X:107502707-107502729 ATCTTCATAGAGAAATGGCCTGG No data
1195675219_1195675227 12 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675227 X:107502718-107502740 GAAATGGCCTGGGAATGGAGAGG No data
1195675219_1195675226 7 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195675219 Original CRISPR TGTCAAGGGCTTTTTTTTGG TGG (reversed) Intergenic
No off target data available for this crispr