ID: 1195675221

View in Genome Browser
Species Human (GRCh38)
Location X:107502697-107502719
Sequence TCTCTATGAAGATTTGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195675221_1195675231 16 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675231 X:107502736-107502758 AGAGGGGCATTGAACTAGAATGG No data
1195675221_1195675228 -1 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675228 X:107502719-107502741 AAATGGCCTGGGAATGGAGAGGG No data
1195675221_1195675229 0 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675229 X:107502720-107502742 AATGGCCTGGGAATGGAGAGGGG No data
1195675221_1195675226 -7 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675221_1195675227 -2 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675227 X:107502718-107502740 GAAATGGCCTGGGAATGGAGAGG No data
1195675221_1195675232 24 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675232 X:107502744-107502766 ATTGAACTAGAATGGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195675221 Original CRISPR TCTCTATGAAGATTTGTCAA GGG (reversed) Intergenic
No off target data available for this crispr