ID: 1195675226

View in Genome Browser
Species Human (GRCh38)
Location X:107502713-107502735
Sequence ATAGAGAAATGGCCTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195675222_1195675226 -8 Left 1195675222 X:107502698-107502720 CCTTGACAAATCTTCATAGAGAA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675218_1195675226 8 Left 1195675218 X:107502682-107502704 CCCACCAAAAAAAAGCCCTTGAC No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675220_1195675226 4 Left 1195675220 X:107502686-107502708 CCAAAAAAAAGCCCTTGACAAAT No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675217_1195675226 9 Left 1195675217 X:107502681-107502703 CCCCACCAAAAAAAAGCCCTTGA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675221_1195675226 -7 Left 1195675221 X:107502697-107502719 CCCTTGACAAATCTTCATAGAGA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data
1195675219_1195675226 7 Left 1195675219 X:107502683-107502705 CCACCAAAAAAAAGCCCTTGACA No data
Right 1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195675226 Original CRISPR ATAGAGAAATGGCCTGGGAA TGG Intergenic
No off target data available for this crispr