ID: 1195675556

View in Genome Browser
Species Human (GRCh38)
Location X:107504813-107504835
Sequence ACTCAAGGACTGCAGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195675556_1195675564 -5 Left 1195675556 X:107504813-107504835 CCAGACACCTGCAGTCCTTGAGT No data
Right 1195675564 X:107504831-107504853 TGAGTTGGGTGGGCTCAAGTGGG No data
1195675556_1195675563 -6 Left 1195675556 X:107504813-107504835 CCAGACACCTGCAGTCCTTGAGT No data
Right 1195675563 X:107504830-107504852 TTGAGTTGGGTGGGCTCAAGTGG No data
1195675556_1195675565 1 Left 1195675556 X:107504813-107504835 CCAGACACCTGCAGTCCTTGAGT No data
Right 1195675565 X:107504837-107504859 GGGTGGGCTCAAGTGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195675556 Original CRISPR ACTCAAGGACTGCAGGTGTC TGG (reversed) Intergenic
No off target data available for this crispr