ID: 1195679883

View in Genome Browser
Species Human (GRCh38)
Location X:107537096-107537118
Sequence ATGGCCCCTTTGCTGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195679872_1195679883 11 Left 1195679872 X:107537062-107537084 CCCCCTGTTCTGCTTACTCTGCA No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data
1195679874_1195679883 9 Left 1195679874 X:107537064-107537086 CCCTGTTCTGCTTACTCTGCAGG No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data
1195679876_1195679883 8 Left 1195679876 X:107537065-107537087 CCTGTTCTGCTTACTCTGCAGGT No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data
1195679870_1195679883 28 Left 1195679870 X:107537045-107537067 CCTCCAACATTTTCTTACCCCCT No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data
1195679871_1195679883 25 Left 1195679871 X:107537048-107537070 CCAACATTTTCTTACCCCCTGTT No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data
1195679873_1195679883 10 Left 1195679873 X:107537063-107537085 CCCCTGTTCTGCTTACTCTGCAG No data
Right 1195679883 X:107537096-107537118 ATGGCCCCTTTGCTGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195679883 Original CRISPR ATGGCCCCTTTGCTGCGGCC AGG Intronic