ID: 1195682861

View in Genome Browser
Species Human (GRCh38)
Location X:107561853-107561875
Sequence CTCAGGTAACATTTTTTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195682861 Original CRISPR CTCAGGTAACATTTTTTTCG AGG Intronic
900668548 1:3833743-3833765 CTCAGTTAACATTATTCTCAGGG - Intronic
901696462 1:11011801-11011823 CTTGGGTGACATTTTTTTGGGGG + Intergenic
903388484 1:22945779-22945801 CCCAGGTAAGATTTGTCTCGTGG - Intergenic
903719697 1:25395610-25395632 CTCTGGTGACATTTTCTTCCTGG + Intronic
904626219 1:31805305-31805327 CTCAGTTTATATTTTTTTGGTGG - Intronic
906579022 1:46919329-46919351 CTCAGTTAATTTTTTTTTAGTGG - Intergenic
907028006 1:51141328-51141350 CTCAGCTAATTTTTTTTTGGAGG - Intronic
910291779 1:85606542-85606564 CTGAGGTAACATTTTCATCTTGG + Intergenic
912012540 1:104985730-104985752 CTTAGGTTACATTTATTTCCAGG + Intergenic
913053563 1:115137718-115137740 CTCAGGTAACTATTTCTTAGGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
920288293 1:204897732-204897754 CTCAGCTAATTTTTTTTTGGGGG + Intronic
923844060 1:237708661-237708683 CTCAGTAAACATTTTTTTAATGG + Intronic
924156436 1:241181648-241181670 CTCAGGAAACATTTCTTCCAAGG + Intronic
924725549 1:246666695-246666717 CTCAGGCAACAGTTTTGTCACGG + Exonic
1062997077 10:1876114-1876136 CTAAGTTATCATTTTTTTCATGG + Intergenic
1065308472 10:24391215-24391237 CTCAGGCACCATTATTTTAGAGG + Intronic
1065451267 10:25860485-25860507 CTCACACAACATTTTTTTCAAGG - Intergenic
1065511457 10:26482647-26482669 ATCTGGCAACATTTTTTTCTAGG - Intronic
1066618543 10:37320968-37320990 CCCAGGTAGCATTTTTCTCTTGG - Intronic
1066990776 10:42511170-42511192 CTCAGCTTACATTTATTTGGGGG + Intergenic
1067183062 10:44005130-44005152 CTGAGCTTACATTTTTTTCAAGG + Intergenic
1067875572 10:50004193-50004215 CTCAGATAATTTTTTTTTGGGGG - Intronic
1068740233 10:60460680-60460702 CTGAGGTACAATTTTTTTGGTGG - Intronic
1069059146 10:63875569-63875591 CACAGTTACCATTTTTTTGGTGG + Intergenic
1076180885 10:128406250-128406272 CTCAGATTCCATTTTTTTAGGGG + Intergenic
1077078335 11:711212-711234 CTCAGGAAATGTTTTTTTGGGGG + Intronic
1082977014 11:59082693-59082715 GTCAGCATACATTTTTTTCGGGG + Intergenic
1087946700 11:104169918-104169940 CTCAGGAAACAAATTGTTCGTGG - Intergenic
1090840133 11:130480195-130480217 CTCGAGAAACATTTTTTTGGGGG + Intergenic
1093230989 12:16541664-16541686 CTCAGGTCTCTTTTTTTTCAAGG + Intronic
1094082259 12:26550581-26550603 CTCAGGTGGCATTCTTTTAGTGG + Intronic
1095054743 12:37585492-37585514 CTCAGGTAAGCTTTTTGTTGGGG + Intergenic
1095159264 12:38897357-38897379 CTCTGGTTACTTTTTTTTCCTGG - Intronic
1095611175 12:44129555-44129577 CCCAGGGAACATTTGCTTCGAGG + Intronic
1095820185 12:46469923-46469945 CTCAGGTCACTTTTGTTTCTGGG + Intergenic
1098373974 12:69792300-69792322 CTCAGTTACCTTTTTTTTGGAGG - Intronic
1098404239 12:70107646-70107668 CTCAGGTAGTATTTTTATAGTGG - Intergenic
1099631451 12:85150944-85150966 CATAGTTAACATTTTTTTTGTGG + Intronic
1101138885 12:101774261-101774283 CTGAATTAACATTTTTTTCTTGG - Intronic
1106352607 13:28948244-28948266 CTGAGGTAACATTATTTGCTTGG - Intronic
1107688875 13:42932098-42932120 CTCAGCTAATATTTTTTTAGAGG + Intronic
1108507017 13:51121338-51121360 CCCAGGTATCATTTTTCTCAAGG - Intergenic
1109157980 13:58935254-58935276 CTCAGCTAACATTTTTTCCTAGG + Intergenic
1111093280 13:83475228-83475250 ATGAGGTAATATTTTTTTTGTGG - Intergenic
1111956298 13:94762266-94762288 CTCAATTAAAATTTTTTTTGTGG - Intergenic
1115965457 14:38882429-38882451 CTCATGTAAAATTTTTTCCTTGG - Intergenic
1120925157 14:89790433-89790455 CTCTGCTAAAATTTTTTTCAAGG + Intergenic
1121062325 14:90924551-90924573 CTCAAGTAACAATTTTCTCAAGG + Intronic
1121601142 14:95203860-95203882 CGCTGGTGACATTTTTTTGGTGG - Exonic
1123818158 15:24000341-24000363 CTCAGTTAAAATTATTTTGGGGG + Intergenic
1125398459 15:39275017-39275039 CTCCTGTAAGATTTTTTTCTGGG - Intergenic
1129502467 15:76052565-76052587 TACATGTAACATTTTTTTCTTGG - Intronic
1129559005 15:76545943-76545965 CTCTGGGAATATTTTTTTAGGGG - Intronic
1134402413 16:13921415-13921437 CTCAGCTGACATTTTTCTCCCGG - Intronic
1142738461 17:1916687-1916709 GTCAGGTAACCTATTTTTCGGGG + Intergenic
1143957479 17:10683603-10683625 ATGAGGTAACATTTTTCTCTTGG - Intronic
1144095954 17:11901023-11901045 CTCAGATAACATGGTTTTCTAGG + Intronic
1145375413 17:22342968-22342990 CTCAGGTAAGCTTTTTGTTGGGG + Intergenic
1148502142 17:48100222-48100244 GTGAGGTAATATTTGTTTCGTGG - Intronic
1148903261 17:50894510-50894532 CTCTGTTAACATTTTTGTGGTGG + Intergenic
1149174307 17:53851498-53851520 CTCAGGAAACATTTCTATTGTGG + Intergenic
1150732685 17:67709749-67709771 CTCTGCTAAAATTTTTTTGGAGG - Intergenic
1154956702 18:21265000-21265022 CTAAGGTAACAGATTTTTAGAGG + Intronic
1156985932 18:43351497-43351519 CCCAGGTAACACTTTTTTGTTGG + Intergenic
1157260758 18:46174057-46174079 CTCTGGTGACATTTTCTTGGGGG + Exonic
1158186184 18:54774438-54774460 CTCAGGTTACATGGTTTTCAGGG + Intronic
1164928509 19:32151948-32151970 TGCAGGTAACATTTTTTTTCTGG - Intergenic
1165683704 19:37799696-37799718 CTCAGGTAAGCTTTTTGTTGGGG - Intronic
1167731117 19:51256670-51256692 CACAGTTACCATTTTTTTGGTGG - Intronic
1168355168 19:55695831-55695853 CTCAGGTCACATCTCTTTCTCGG + Intronic
927373344 2:22383360-22383382 CTCAGGTAATATGATTTTCCTGG - Intergenic
929135409 2:38619149-38619171 CTGAGATAACATTTTTTTCAGGG - Intergenic
930394605 2:50805257-50805279 CTCACGTAATATGTTTTTAGAGG - Intronic
931797261 2:65723145-65723167 CTCAGGTAACACCCTTTTCCAGG + Intergenic
933675951 2:85057754-85057776 ATCAAGTCACATTTTATTCGAGG - Exonic
935526360 2:104172705-104172727 GTCAGATAACTTTTTTTTTGGGG + Intergenic
936702578 2:115031163-115031185 CTCAGGAAAAATATTTTTCAAGG + Intronic
936890953 2:117369558-117369580 CTCCTGTAACATTTTTCTCCAGG + Intergenic
937563822 2:123259317-123259339 CTCAGAGAACAAATTTTTCGGGG + Intergenic
940422343 2:153494732-153494754 CTAAGTTACCATTTTTTTCTTGG - Intergenic
945265987 2:207891925-207891947 CTCAGGTGACATTTTATTTGGGG + Intronic
945295313 2:208164869-208164891 ATGAGGAAACATTTTTTTCTCGG - Intergenic
945741804 2:213672441-213672463 CTCAGGTAAGATTTTTTAAAAGG + Intronic
946099412 2:217306424-217306446 ATTAGCTAACATTTTTTTCTTGG - Intronic
1169610552 20:7375164-7375186 TTCAGATAACTTTTTTTTGGTGG - Intergenic
1175020743 20:55846193-55846215 CTCTGGTAACACTTTATTTGTGG + Intergenic
1176004254 20:62851210-62851232 GTCAGTTCACAATTTTTTCGGGG - Intronic
1177886089 21:26747427-26747449 CTCTGGTATCTTTTTTTACGAGG - Intergenic
1180909641 22:19440381-19440403 CTTAGGCAACATTTTTATCCAGG - Intronic
1182075353 22:27491777-27491799 TTAAGATAACATGTTTTTCGAGG - Intergenic
1182776178 22:32832886-32832908 CCCAGCTAATTTTTTTTTCGTGG + Intronic
951866483 3:27314279-27314301 CTCAGGTAAGATTCCTTTTGTGG - Exonic
952969206 3:38640481-38640503 CTCAGGTAGAATTTTTTTAAGGG - Intronic
955567540 3:60264182-60264204 CTCAGAGAACATTTTCTTCTAGG - Intronic
955971145 3:64439726-64439748 TTCAGATAACACTTTTTTCTGGG + Intronic
956381311 3:68667236-68667258 CACAGGCAACATTTCTTTAGGGG + Intergenic
957166193 3:76676806-76676828 CTCAGGTAACATCTGTTCCCAGG + Intronic
959964653 3:112339584-112339606 CACAGGTATTATTTTTTTCTTGG - Intronic
964353836 3:155830600-155830622 CTCATCTAACATTTTCTCCGTGG - Intronic
965331252 3:167377572-167377594 CTCATTTAACATTTCTTTCTTGG - Intronic
967394502 3:188991899-188991921 CTCAGTAATTATTTTTTTCGAGG + Intronic
967786955 3:193507620-193507642 CTCAGCATACATTTTTTTGGAGG + Intronic
970437066 4:16046029-16046051 CTCAGGTAACAGTGTTATCCTGG + Intronic
971612011 4:28737674-28737696 ATCAGATATCATTTTTTTCCTGG + Intergenic
971858782 4:32078367-32078389 TTCAGGAAACATATTTATCGAGG + Intergenic
972549757 4:40120033-40120055 CTCAGGTAACATTGTTTCTTTGG - Exonic
973236586 4:47913174-47913196 TTCAGGATACATTTTTTTGGGGG - Intronic
973538003 4:51904223-51904245 CTAAGGCAATATTTTTTTTGAGG + Intronic
976930071 4:90555247-90555269 CTCAGGAAAAATTTTTTGCCAGG - Intronic
977091007 4:92675853-92675875 CTGAGCTACCATTTTTTTAGTGG + Intronic
977983315 4:103351921-103351943 AGCAGGTAACTTTTTTTTGGTGG - Intergenic
979220109 4:118212873-118212895 CTCAGGTAACATGTATTTCTTGG + Intronic
980512627 4:133813337-133813359 CTCCTGTAACATTTTTATCATGG - Intergenic
981509522 4:145540468-145540490 CTCAGGAAATATTTTTTCTGAGG - Intronic
981703515 4:147634190-147634212 CTCGGGAAACAATTTTTTCCTGG - Exonic
982906304 4:161078696-161078718 ATCAGGAAACATTTTTCTAGTGG - Intergenic
983154448 4:164328950-164328972 TTCAGTTAAGATTTTTTTCCTGG + Intronic
985339417 4:188933395-188933417 CTCAGGTAAGACTTTTTTAAAGG - Intergenic
986220600 5:5765563-5765585 CTCAGGATGCATTTTTTTCTGGG + Intergenic
986398116 5:7350808-7350830 CTCATTTACCATTTTTTTCATGG + Intergenic
989706641 5:44340722-44340744 CACAGCTAACCTTTTTTTCTAGG + Intronic
993163534 5:84320179-84320201 TGCAGGCAACATTTTTTTTGGGG - Intronic
999801663 5:155044209-155044231 CTCAGGTATGTTTTTATTCGCGG - Intergenic
1000716589 5:164651973-164651995 CCCAGGTCCCAATTTTTTCGAGG - Intergenic
1003560124 6:7173164-7173186 CTGTGGGAACATTTTTTTCAGGG + Intronic
1003655473 6:8003102-8003124 CTCCTGTAACATTTTGTTCTTGG - Intronic
1005018475 6:21395627-21395649 GTCAGGTAACATTTTTGGCATGG - Intergenic
1008667481 6:53730469-53730491 CGCAGGTAACATTTTGTAAGGGG + Intergenic
1009673118 6:66782109-66782131 CTCAGGTAAAATTTTTGGAGTGG + Intergenic
1014421767 6:121254768-121254790 CTCGGGCAACATGTTTTTCTGGG - Intronic
1015270453 6:131332889-131332911 TTCAGTTAACATGTTTTTCTTGG - Intergenic
1016370882 6:143372769-143372791 CTGAGGCAAGATTTTTTTGGAGG + Intergenic
1017496545 6:154988687-154988709 CACAGGTAACTTTTTTTTTTTGG + Intronic
1021602373 7:22377256-22377278 CTGAGGTAACATTTATTTGTAGG + Intergenic
1022933462 7:35147126-35147148 CCCAGAGAACATTTTTTTCATGG + Intergenic
1025298130 7:57793056-57793078 CTCAGGTAAGGTTTTTGTTGGGG + Intergenic
1027412660 7:77937946-77937968 CACATGTAACTTTTTTTTCAGGG - Intronic
1027808162 7:82856587-82856609 CCCATGTAACATTATTTTCTAGG - Intronic
1027873337 7:83738450-83738472 CTCAGGTTACATGTTTATCTGGG - Intergenic
1030863590 7:114669902-114669924 CTCATTTAACATTTTATACGAGG - Intronic
1031161356 7:118172500-118172522 CACAGCTAACATTTATTTCATGG - Intergenic
1031429184 7:121645432-121645454 CTCACTTAACATAATTTTCGAGG + Intergenic
1037668333 8:20992291-20992313 CACAGGTAACATTATATTAGTGG + Intergenic
1038163123 8:25059462-25059484 CTCATGTAGGATTTTTTTCCAGG - Intergenic
1039155939 8:34557008-34557030 CTCAGGAAACATGCTTTTCTTGG + Intergenic
1043305954 8:78795551-78795573 CTCATGACACATTTTTTTGGTGG - Intronic
1044560852 8:93610590-93610612 ATCAGGTAAAATTTATTTCTGGG - Intergenic
1050081724 9:1922441-1922463 CTCAGGAAACATATTTTGCAAGG + Intergenic
1050221908 9:3400728-3400750 CTCATGTAATAGTTTTTTCCTGG + Intronic
1051403790 9:16712076-16712098 CACAGGTAACATTTTTGTCTTGG - Intronic
1053402244 9:37835575-37835597 CCCAGGTAACTTTTTTTTTTTGG - Intronic
1053605289 9:39652174-39652196 CACAGGTAACATTTATATCCTGG + Intergenic
1053795470 9:41722981-41723003 CTCAGGTAAGCTTTTTGTTGGGG - Intergenic
1053863206 9:42408801-42408823 CACAGGTAACATTTATATCCTGG + Intergenic
1053865119 9:42429388-42429410 CCCAGGTAATTTTTTTTTCATGG + Intergenic
1054149711 9:61591895-61591917 CTCAGGTAAGCTTTTTGTTGGGG + Intergenic
1054183880 9:61935036-61935058 CTCAGGTAAGCTTTTTGTTGGGG - Intergenic
1054248254 9:62690242-62690264 CACAGGTAACATTTATATCCTGG - Intergenic
1054469477 9:65523005-65523027 CTCAGGTAAGCTTTTTGTTGGGG + Intergenic
1054562369 9:66724767-66724789 CACAGGTAACATTTATATCCTGG - Intergenic
1054654625 9:67653450-67653472 CTCAGGTAAGCTTTTTGTTGGGG + Intergenic
1054702368 9:68425961-68425983 CTCAGCTAAGATTTTTATAGTGG + Intronic
1057092962 9:92276669-92276691 TTCAGCGAACATTTTTTTCTGGG + Intronic
1058477402 9:105351677-105351699 AACAGATAACATTTTTTTCTTGG - Intronic
1060417493 9:123442552-123442574 TTCAGGTAAAATTTTGTGCGTGG + Intronic
1186257900 X:7742417-7742439 CACAGGAATCATTTTTTTCTAGG + Intergenic
1189182616 X:39018113-39018135 CCCAGGCAACATTTATTTTGGGG + Intergenic
1189184068 X:39036627-39036649 GCCAGGTAAAATTTTTTTCCAGG + Intergenic
1189238193 X:39505141-39505163 CTCAGGGAACATTGTGTTCCCGG + Intergenic
1194687464 X:96939961-96939983 CCCAGGTAACATTTTTTAAAAGG + Intronic
1195621805 X:106963781-106963803 CTCAGCTTGCATTTTTTTCTGGG - Intronic
1195661596 X:107384441-107384463 CTAAGGTCACATTCTTTTTGGGG - Intergenic
1195682861 X:107561853-107561875 CTCAGGTAACATTTTTTTCGAGG + Intronic
1197731054 X:129810357-129810379 CTCAAGTAATATTTTTTTTTAGG + Intronic
1199218818 X:145293215-145293237 TTCTGCTAACATTTTTTTGGTGG - Intergenic
1201394627 Y:13535730-13535752 TTCATGTAACCTTTTTTTCAAGG + Intergenic
1202046805 Y:20743736-20743758 CTCTGGTCAAATTTTTTTCTGGG + Intergenic