ID: 1195684923

View in Genome Browser
Species Human (GRCh38)
Location X:107576880-107576902
Sequence TACTTCACATATTAGACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195684923 Original CRISPR TACTTCACATATTAGACCTA AGG Intronic
910135340 1:83961796-83961818 TACGTCACATATTATTCATAGGG - Intronic
911717159 1:101146337-101146359 TCCTTCACTTTTTTGACCTAAGG - Intergenic
911950687 1:104170493-104170515 TACTTCACAAATTCCACCCATGG - Intergenic
916573470 1:166047194-166047216 TTCTTCACCTATAAAACCTATGG + Intergenic
917220021 1:172718696-172718718 GAGTTCAAATATTAGACTTAAGG + Intergenic
919346055 1:196379826-196379848 TAATTCACATTTTAGAGATAAGG - Intronic
923929324 1:238675656-238675678 ACTTTCACATATTAAACCTAAGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1067674547 10:48360617-48360639 TAGTTCACAAATTGGGCCTATGG - Intronic
1074615443 10:115062860-115062882 TTCTTTACATATGAGACCTGTGG - Intergenic
1079097402 11:17519872-17519894 TGGGTCACATATGAGACCTATGG - Intronic
1079208468 11:18439017-18439039 TACTTTACATAATAGCCTTATGG + Intronic
1079756941 11:24275728-24275750 TACTTAACATATTGGATGTAGGG + Intergenic
1084170678 11:67399475-67399497 GACTTCCCAGATGAGACCTAAGG + Intronic
1088060277 11:105641264-105641286 CACTACAGACATTAGACCTAAGG + Intronic
1088636805 11:111829023-111829045 TACTTTAGCTTTTAGACCTATGG - Intronic
1097419790 12:59361811-59361833 TATTTCACAAATTAGATCAAGGG + Intergenic
1097967508 12:65596492-65596514 TACTTCACCCATTAGACCAGGGG - Intergenic
1098967936 12:76813246-76813268 TACTTCTCATATAAGAAATAAGG + Intronic
1100948592 12:99818537-99818559 TACTTTACATTTAAGACATAGGG - Intronic
1109439345 13:62349320-62349342 TGCTTCACATATCAGACTCAAGG - Intergenic
1121724102 14:96133586-96133608 TTCTTCACAGATTTGACCCAAGG - Intergenic
1127758921 15:62119169-62119191 TACGTCACTTATAAGATCTAAGG - Intergenic
1131802072 15:96081064-96081086 TACCCCACACTTTAGACCTATGG - Intergenic
1133900789 16:9972338-9972360 TACTTTACATATAAGAAGTAGGG + Intronic
1133900793 16:9972392-9972414 TACTTTACATATAAGAAATAGGG + Intronic
1135891503 16:26361372-26361394 CATTTTACATTTTAGACCTAGGG + Intergenic
1156324116 18:36057806-36057828 TACTTCAAATCTTAAACCAAAGG + Intronic
929765189 2:44838284-44838306 TGCTTCCCATATTACAGCTAGGG + Intergenic
932541745 2:72662614-72662636 CACTACACATATAAAACCTAGGG + Intronic
933196494 2:79396027-79396049 TACTTCACATATTAGAAAACAGG - Intronic
935002160 2:99029211-99029233 CACTTCTCATATTATGCCTAAGG + Intronic
935337869 2:102033953-102033975 TAATTCACATTTTAGAGGTAAGG + Intergenic
937721010 2:125096272-125096294 TAGTACACATAGTAGGCCTAGGG + Intergenic
940704332 2:157084822-157084844 TATTTCACCTATTACACATAAGG - Intergenic
946323650 2:218970431-218970453 TACTTCTCATATTTTACCAATGG + Intergenic
946533198 2:220595991-220596013 GAATTCACTTATTAGATCTAGGG - Intergenic
1171797129 20:29575425-29575447 TTCTTCACATTTTAGACGTGAGG - Intergenic
1173175311 20:40760348-40760370 CATTTCACATATGAGACCTCAGG + Intergenic
1173278462 20:41605061-41605083 TACTTTACATATTTATCCTAAGG - Intronic
1173710375 20:45150463-45150485 TTCTTTACCCATTAGACCTAGGG + Intergenic
1174260132 20:49288281-49288303 TATTTAACATCTTAGACGTAAGG - Intergenic
1181848184 22:25730065-25730087 TACGTAACACATTAGACCAAGGG - Intergenic
1182005819 22:26958734-26958756 TGATTCACATATCAGGCCTAGGG + Intergenic
1183874025 22:40763805-40763827 TACTTTAAAAATTAGACATAGGG - Intergenic
956161568 3:66359304-66359326 TTCATCAAATATTAGACCTAGGG + Intronic
958574157 3:95926012-95926034 TACATCAGATAATTGACCTATGG + Intergenic
959240784 3:103790863-103790885 CAATTCACACATTATACCTAAGG - Intergenic
961463815 3:127069576-127069598 TAATTCTCATTTTTGACCTATGG - Intergenic
962903911 3:139784699-139784721 TTCTTCTCATATTAGAGGTAGGG - Intergenic
971548088 4:27912955-27912977 TACTTCTCATTTTACACATAAGG + Intergenic
975649689 4:76580339-76580361 TACTGCACATATTGGATTTACGG - Intronic
976195384 4:82527072-82527094 TACTTCACAGAGTAAACCTCAGG + Intronic
976987887 4:91325698-91325720 TGGTTCACATATTAGTCATATGG - Intronic
977755475 4:100666653-100666675 CACTTCACATTTTAGCCATAGGG + Intronic
980761503 4:137239393-137239415 TCCTTGACATATTAGAACGATGG - Intergenic
982475982 4:155851204-155851226 TCATTCAAATATTAGCCCTATGG - Intronic
984588418 4:181589008-181589030 GACATCATATATTAGACATAAGG + Intergenic
985316344 4:188662173-188662195 TACTGCATAAATTAGACATAAGG + Intergenic
988449364 5:31324949-31324971 GACTTCACTTATTAGTCTTAGGG + Exonic
988782113 5:34531873-34531895 TTCTTCACATTTTAGAGATACGG + Intergenic
990768890 5:59220491-59220513 TACTTCAAATATTAGAACTAGGG + Intronic
993683870 5:90914007-90914029 TACTTCATATGTTAAACCAAGGG - Intronic
996512293 5:124330178-124330200 TTCTTCACATGGTGGACCTATGG + Intergenic
1001428120 5:171638182-171638204 TACTTCCCAAACTAGAACTAGGG - Intergenic
1005632340 6:27720204-27720226 TACCTCACATATTACACCAGAGG + Intergenic
1008162385 6:48094268-48094290 TTCTTCACAAATTAGTCCTCTGG - Intergenic
1011860713 6:91752749-91752771 TACTTCCCCAATTAGACCTTCGG - Intergenic
1015970759 6:138740851-138740873 AACTTCACATATGAGAACTGGGG - Intergenic
1021865099 7:24948329-24948351 TACTTCAGAAGGTAGACCTATGG + Intronic
1022575928 7:31496899-31496921 CACTTCACATATTACCCCAAGGG - Intergenic
1023469646 7:40501252-40501274 TACTTAAAATATTACACCCAGGG - Intronic
1025214467 7:57044280-57044302 TACTTCCTATAATAGACTTATGG + Intergenic
1025657487 7:63532533-63532555 TACTTCCTATAATAGACTTATGG - Intergenic
1028008368 7:85607952-85607974 TAATTCAGATATTAGAATTATGG + Intergenic
1029702707 7:102258189-102258211 TACTTCAATTATCACACCTAGGG - Exonic
1030269794 7:107658984-107659006 TACTTTACATATTTGATCTAAGG - Intergenic
1033988611 7:147256683-147256705 AACTTCACATGTTAGTCCTCAGG - Intronic
1034051923 7:147992861-147992883 TACTTAATACATTAGACATAGGG - Intronic
1040848691 8:51875034-51875056 TACTTCAAATATTAGAACACAGG + Intronic
1051090306 9:13399447-13399469 TACATCACATATAACACCTGAGG + Intergenic
1059287086 9:113183342-113183364 TGATTCCCATATAAGACCTAAGG - Intronic
1060874940 9:127076452-127076474 TACTTCACATGTTAGAAGTCTGG - Intronic
1189620426 X:42831252-42831274 TACTTCACATGTAAGAGCTCTGG - Intergenic
1192295881 X:69847229-69847251 TACTAGACATATCAGACATATGG + Intronic
1193198632 X:78662309-78662331 TATTTAACATATTATTCCTATGG + Intergenic
1193417715 X:81243883-81243905 TATTTGACCTATTAGACATAAGG - Intronic
1195684923 X:107576880-107576902 TACTTCACATATTAGACCTAAGG + Intronic
1196343380 X:114623192-114623214 TATTTAACATATGAGGCCTAGGG + Intronic
1197117035 X:122845614-122845636 TACTTCTCATAGTAGAGCTTAGG - Intergenic