ID: 1195687996

View in Genome Browser
Species Human (GRCh38)
Location X:107602731-107602753
Sequence CCTCCGTGTGTCCACCTTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195687989_1195687996 7 Left 1195687989 X:107602701-107602723 CCCTGAGGCCTCCCGCACTCAGG 0: 1
1: 0
2: 0
3: 20
4: 152
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75
1195687991_1195687996 6 Left 1195687991 X:107602702-107602724 CCTGAGGCCTCCCGCACTCAGGA 0: 1
1: 0
2: 0
3: 7
4: 178
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75
1195687993_1195687996 -4 Left 1195687993 X:107602712-107602734 CCCGCACTCAGGAGATTGACCTC 0: 1
1: 0
2: 0
3: 23
4: 237
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75
1195687992_1195687996 -1 Left 1195687992 X:107602709-107602731 CCTCCCGCACTCAGGAGATTGAC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75
1195687994_1195687996 -5 Left 1195687994 X:107602713-107602735 CCGCACTCAGGAGATTGACCTCC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75
1195687987_1195687996 23 Left 1195687987 X:107602685-107602707 CCTGCAGCAGCAGCAGCCCTGAG 0: 1
1: 0
2: 15
3: 136
4: 756
Right 1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195687996 Original CRISPR CCTCCGTGTGTCCACCTTCG AGG Exonic
906536722 1:46554847-46554869 CCTCTGTGTGTCTACCTGCCTGG - Intergenic
907574738 1:55516017-55516039 CCTCTGTGTGTGCACATTCCTGG + Intergenic
922891653 1:229066466-229066488 CCTCCATGTGTCCAGCTATGGGG + Intergenic
1063631432 10:7737276-7737298 CCTGGGTGTGTGCACCCTCGGGG - Intronic
1069958841 10:72067961-72067983 CCTCCCTCTGCCCACCTTCCAGG + Intronic
1070968519 10:80544588-80544610 CTTCCGTGTGTCCTCTTTCCAGG + Intronic
1072921183 10:99578582-99578604 CCTCCCTGAGTACACCTTCACGG + Intergenic
1075453399 10:122568863-122568885 CTTCCCTGTGGCCACATTCGTGG - Intronic
1083852400 11:65375984-65376006 CCTCCGCCTTTCCACCTTCCGGG - Exonic
1087465131 11:98494870-98494892 CCTCCGAGTGTCCTCCTGTGGGG + Intergenic
1089792028 11:120952532-120952554 CCACCCTGTGTCCTCCATCGGGG - Intronic
1091817627 12:3452113-3452135 CCTCTGTGTGTCCATCTTTGTGG - Intronic
1100141837 12:91628516-91628538 CCTCCATCTGTTCACCTTTGGGG - Intergenic
1103134859 12:118498540-118498562 CCTCCGTGTGTGCACATCCCCGG + Intergenic
1112183143 13:97104666-97104688 CCTCCGTGTGTTCACCAACCTGG + Intergenic
1123116964 14:105899219-105899241 CCTCCCTGGTTCCTCCTTCGGGG - Intergenic
1129376822 15:75138736-75138758 CTTCCCTGTGTCCCCCTTCCAGG - Intergenic
1130637833 15:85642073-85642095 CCTACCTGTGTCCACCTTTAAGG + Intronic
1133054437 16:3138482-3138504 CCTCCGTGCCCCCACCGTCGGGG - Exonic
1136144476 16:28308116-28308138 CCTCAGCGTGTCCACCTCCCTGG - Intronic
1141296122 16:82771530-82771552 CCTCACTGTCTCCACTTTCGGGG - Intronic
1148122389 17:45221076-45221098 CCTCCTTGGGACCACCTTGGCGG + Intergenic
1151247674 17:72807631-72807653 CCTCCGTGTGTTCACCAACCTGG - Intronic
1152615523 17:81336139-81336161 CCCCTGTCTGTCCACCTTCAGGG + Intergenic
1157562588 18:48659364-48659386 CCTCCATGTGTCCAGCTCAGCGG + Intronic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1160427873 18:78790700-78790722 CATCTGTGTGTCCACCTTTCTGG - Intergenic
1160908101 19:1461146-1461168 CCACCGGGTGCCCACCTTGGTGG - Exonic
1161087810 19:2343271-2343293 CATCCGTCTGCCCACCTTCAAGG + Exonic
1164514601 19:28923020-28923042 CTTCTGTGTGTCCTCCTTAGAGG - Intergenic
1167247869 19:48384565-48384587 CTTCCTTCTCTCCACCTTCGCGG - Intronic
928364534 2:30691132-30691154 CCTCCTTTAGTCCAGCTTCGTGG + Intergenic
948179773 2:235970491-235970513 CCCCTGTGTGTGCACCTTAGGGG - Intronic
948295630 2:236858175-236858197 CCTCCGGGTGTCCACCACCAGGG - Intergenic
948612221 2:239177083-239177105 TCTCCAAGTGTCCACCTTCGAGG - Intronic
949041407 2:241851597-241851619 CATGCGTGTGCCCACCTGCGAGG - Intronic
1172895922 20:38300006-38300028 CCTCTGTGTGTCCGGCTTCCAGG - Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
1178951743 21:36990882-36990904 CCTCTGTGTGCCCACCTGCCTGG + Intergenic
1182442879 22:30374409-30374431 CTTCTGTGTGTCCCCCTTCTTGG + Exonic
1184137915 22:42560248-42560270 CTTACCTGTGGCCACCTTCGTGG - Exonic
951135235 3:19097554-19097576 CCTTCCTGTGTCCACCTATGCGG + Intergenic
955154009 3:56397889-56397911 CCTCCCAGTGTCCACATTCCAGG + Intronic
955547604 3:60048059-60048081 TCACCGTGTGTGCACCTTCCTGG + Intronic
963923675 3:150929280-150929302 TCTCCCAGTGTCCATCTTCGGGG - Intronic
965743449 3:171900641-171900663 CCTCCTTGTTTCCACCCACGTGG - Intronic
967845246 3:194037751-194037773 CCTCCCACTGGCCACCTTCGTGG + Intergenic
971352138 4:25863606-25863628 CCTCCACCTGTCCACCTGCGGGG + Intronic
975921890 4:79400792-79400814 CCTCCCTGCTTCCACCTTTGTGG - Intergenic
985741252 5:1618669-1618691 CCCCCGGGTGTCCAGCTTCATGG + Intergenic
1000269534 5:159670683-159670705 CCTGCGTGTGGCAACCGTCGTGG - Intergenic
1004924658 6:20404384-20404406 CCTCCGGGTCTTCACCCTCGTGG + Intronic
1007306872 6:40913775-40913797 GCTCTGTGTGTCCACCTCTGCGG - Intergenic
1013174960 6:107669079-107669101 CCTCTGTGAGTCCACCTCCCTGG + Intergenic
1014629854 6:123774883-123774905 CCTCTCTGTTTCCACCTTCTCGG + Intergenic
1014748713 6:125231036-125231058 CCTCTGTCTTTCCACTTTCGTGG + Intronic
1016590006 6:145734788-145734810 CCTCCGAGTCCCCCCCTTCGCGG - Intronic
1017818738 6:158033647-158033669 CGGCCATGTGTCCAACTTCGTGG + Exonic
1018936894 6:168279602-168279624 CCTCCGGGTGTCCACCTGCGAGG + Intergenic
1019291929 7:254862-254884 CCTCTGTCTGGCCTCCTTCGCGG + Intronic
1019718687 7:2555162-2555184 CATCCGTGCGTCCAGCCTCGGGG + Intronic
1021187841 7:17585980-17586002 CATCCAAGTGTCCACCTTTGGGG - Intergenic
1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG + Intergenic
1023708327 7:42965519-42965541 CCTCCATGTGTTCACCTATGTGG - Intergenic
1034674500 7:152882846-152882868 CCTCTGTGTGCCCATCTTCACGG + Intergenic
1035327879 7:158076491-158076513 CCTGCCTGTGTCCACCTCAGCGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1040986248 8:53297095-53297117 CCTCCATGTATCCCCCTTCTAGG + Intergenic
1049570761 8:143369305-143369327 CCTCCTCGTGTCCCCCTTCTGGG + Intronic
1049770397 8:144377800-144377822 CATCCGGGCGTCCACCTTCAAGG + Intronic
1053416672 9:37951209-37951231 CCTCCGGATGTCCAGCTTGGTGG - Intronic
1057180232 9:93025895-93025917 ACGCCCTGTGTCCACCCTCGGGG + Intronic
1058798930 9:108525967-108525989 CCTCGGTGTGTGCAACTTCATGG - Intergenic
1059348217 9:113646634-113646656 CCTCCGTCTGGCCACCCTCGGGG - Intergenic
1060129251 9:121078899-121078921 CCTCCCTGTGTCCAGCTTTCTGG + Intronic
1060517394 9:124274507-124274529 CCTCAGTCTGTCCATTTTCGTGG + Intronic
1062285648 9:135771434-135771456 CCTTCCTGTGGCCACCTTTGTGG + Intronic
1062456292 9:136640788-136640810 CCTCGGTCTGTCCAGCCTCGGGG + Intergenic
1189220540 X:39368009-39368031 CCTCAGTGTGTCCAGCTAGGAGG - Intergenic
1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG + Exonic