ID: 1195698646

View in Genome Browser
Species Human (GRCh38)
Location X:107685309-107685331
Sequence TGCCTCTCCCCAAGGCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195698646_1195698651 23 Left 1195698646 X:107685309-107685331 CCAAAAGGCCTTGGGGAGAGGCA No data
Right 1195698651 X:107685355-107685377 ATGCCCTGCTTCCCAAAGCTTGG No data
1195698646_1195698648 -4 Left 1195698646 X:107685309-107685331 CCAAAAGGCCTTGGGGAGAGGCA No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195698646 Original CRISPR TGCCTCTCCCCAAGGCCTTT TGG (reversed) Intergenic