ID: 1195698647

View in Genome Browser
Species Human (GRCh38)
Location X:107685317-107685339
Sequence AAGCAAGGTGCCTCTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195698647_1195698651 15 Left 1195698647 X:107685317-107685339 CCTTGGGGAGAGGCACCTTGCTT No data
Right 1195698651 X:107685355-107685377 ATGCCCTGCTTCCCAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195698647 Original CRISPR AAGCAAGGTGCCTCTCCCCA AGG (reversed) Intergenic