ID: 1195698648

View in Genome Browser
Species Human (GRCh38)
Location X:107685328-107685350
Sequence GGCACCTTGCTTACAGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195698638_1195698648 12 Left 1195698638 X:107685293-107685315 CCACTCCATAACCGGTCCAAAAG No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698646_1195698648 -4 Left 1195698646 X:107685309-107685331 CCAAAAGGCCTTGGGGAGAGGCA No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698644_1195698648 1 Left 1195698644 X:107685304-107685326 CCGGTCCAAAAGGCCTTGGGGAG No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698633_1195698648 23 Left 1195698633 X:107685282-107685304 CCTTCCCTCCTCCACTCCATAAC No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698636_1195698648 18 Left 1195698636 X:107685287-107685309 CCTCCTCCACTCCATAACCGGTC No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698635_1195698648 19 Left 1195698635 X:107685286-107685308 CCCTCCTCCACTCCATAACCGGT No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698637_1195698648 15 Left 1195698637 X:107685290-107685312 CCTCCACTCCATAACCGGTCCAA No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data
1195698640_1195698648 7 Left 1195698640 X:107685298-107685320 CCATAACCGGTCCAAAAGGCCTT No data
Right 1195698648 X:107685328-107685350 GGCACCTTGCTTACAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195698648 Original CRISPR GGCACCTTGCTTACAGCCAA AGG Intergenic