ID: 1195698649

View in Genome Browser
Species Human (GRCh38)
Location X:107685332-107685354
Sequence TCATCCTTTGGCTGTAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195698649_1195698657 24 Left 1195698649 X:107685332-107685354 CCTTGCTTACAGCCAAAGGATGA No data
Right 1195698657 X:107685379-107685401 GAGAAGCATTTGCTCTTTGTGGG No data
1195698649_1195698658 25 Left 1195698649 X:107685332-107685354 CCTTGCTTACAGCCAAAGGATGA No data
Right 1195698658 X:107685380-107685402 AGAAGCATTTGCTCTTTGTGGGG No data
1195698649_1195698651 0 Left 1195698649 X:107685332-107685354 CCTTGCTTACAGCCAAAGGATGA No data
Right 1195698651 X:107685355-107685377 ATGCCCTGCTTCCCAAAGCTTGG No data
1195698649_1195698656 23 Left 1195698649 X:107685332-107685354 CCTTGCTTACAGCCAAAGGATGA No data
Right 1195698656 X:107685378-107685400 AGAGAAGCATTTGCTCTTTGTGG No data
1195698649_1195698659 26 Left 1195698649 X:107685332-107685354 CCTTGCTTACAGCCAAAGGATGA No data
Right 1195698659 X:107685381-107685403 GAAGCATTTGCTCTTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195698649 Original CRISPR TCATCCTTTGGCTGTAAGCA AGG (reversed) Intergenic