ID: 1195700026

View in Genome Browser
Species Human (GRCh38)
Location X:107698024-107698046
Sequence CTTTCATAGGTCAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195700026_1195700032 -8 Left 1195700026 X:107698024-107698046 CCACCCACTTTGACCTATGAAAG No data
Right 1195700032 X:107698039-107698061 TATGAAAGTGCTGGGATTACAGG 0: 4
1: 970
2: 16771
3: 326804
4: 265213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195700026 Original CRISPR CTTTCATAGGTCAAAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr