ID: 1195700026 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:107698024-107698046 |
| Sequence | CTTTCATAGGTCAAAGTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195700026_1195700032 | -8 | Left | 1195700026 | X:107698024-107698046 | CCACCCACTTTGACCTATGAAAG | No data | ||
| Right | 1195700032 | X:107698039-107698061 | TATGAAAGTGCTGGGATTACAGG | 0: 4 1: 970 2: 16771 3: 326804 4: 265213 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195700026 | Original CRISPR | CTTTCATAGGTCAAAGTGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||