ID: 1195702179

View in Genome Browser
Species Human (GRCh38)
Location X:107713957-107713979
Sequence GCTTTGTGCACAGCCCAGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195702179_1195702181 8 Left 1195702179 X:107713957-107713979 CCACACTGGGCTGTGCACAAAGC 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1195702181 X:107713988-107714010 ATACCATATTAACCAACAGAAGG 0: 2
1: 0
2: 3
3: 18
4: 161
1195702179_1195702183 17 Left 1195702179 X:107713957-107713979 CCACACTGGGCTGTGCACAAAGC 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1195702183 X:107713997-107714019 TAACCAACAGAAGGCTGACTTGG 0: 2
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195702179 Original CRISPR GCTTTGTGCACAGCCCAGTG TGG (reversed) Exonic
900342470 1:2195388-2195410 GCACTGGGCACAGCCAAGTGTGG - Intronic
900416787 1:2538979-2539001 CCTGTGTGCACAGCCCAGAAGGG + Intergenic
900593034 1:3468266-3468288 CCTTTCTGCCCAGCCCAGTGAGG + Intronic
901002730 1:6156681-6156703 GCTGGGGGCACAGCCCAGAGAGG + Intronic
902084160 1:13844872-13844894 GCTCTGTGCTGAGCCCAGAGAGG + Intergenic
903762305 1:25707324-25707346 GCTCTGTGCAGAGCCCAGGTAGG + Intronic
905816240 1:40953156-40953178 GCCTAGTGCACAGGCCACTGCGG + Intergenic
907422228 1:54355210-54355232 GCTGTGTGCCCAGCACAGAGAGG - Intronic
907571317 1:55486619-55486641 GCTGTGTTCACAGCCCAGGCTGG + Intergenic
907706854 1:56839796-56839818 GCTCTGTGAACAGACCAGTGTGG - Intergenic
908738858 1:67307305-67307327 GTCTTGTGCACAGCCCACTTGGG + Intergenic
912447764 1:109750783-109750805 GTTTTGTTCACAGCACGGTGAGG - Exonic
916182195 1:162095043-162095065 TCTTTTTTCATAGCCCAGTGTGG + Intronic
919593927 1:199538190-199538212 GCTCTCTGCTCAGCCCTGTGGGG - Intergenic
919947237 1:202328533-202328555 GCTTTGCTGGCAGCCCAGTGTGG + Intergenic
924799224 1:247315274-247315296 GGGGAGTGCACAGCCCAGTGTGG + Intronic
1062911812 10:1216564-1216586 TTTTTGTGGAAAGCCCAGTGGGG + Intronic
1064028224 10:11866428-11866450 GATTGGTCCACAGCCCAGGGCGG - Intronic
1065843776 10:29728141-29728163 GCTTTGTGGCCAGTCCAGGGTGG - Intronic
1067767515 10:49098188-49098210 GCTGTGTGCCCAGCACTGTGGGG - Intronic
1070661008 10:78305170-78305192 GCTTTGAGGATTGCCCAGTGAGG + Intergenic
1072712417 10:97724701-97724723 GCTCTTTCAACAGCCCAGTGAGG - Intergenic
1072809457 10:98447492-98447514 GCTTTGAGCCCAGCCCAGCAAGG + Intergenic
1073823388 10:107291397-107291419 GCTTTGTGCCCTACCCACTGTGG + Intergenic
1074184846 10:111092264-111092286 TCTTTGTGCACATCCAGGTGTGG - Intergenic
1075588660 10:123675963-123675985 GCATCTTGCACACCCCAGTGAGG + Intronic
1076521873 10:131086378-131086400 GCTTTGGGCAGGGCTCAGTGTGG + Intergenic
1076778922 10:132713453-132713475 TCCTTGTGCAGAGCCCTGTGGGG - Intronic
1077325048 11:1960066-1960088 GCTATGAGCACAGCCCGGTGCGG - Intronic
1078933426 11:15930624-15930646 GCTTTCTGCACAGTCCTGGGTGG - Intergenic
1079443678 11:20540138-20540160 GCTTTTTTCACAGCACAGAGTGG - Intergenic
1081564331 11:44248198-44248220 GCTTGGGGAACAGCCCACTGTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084769630 11:71334330-71334352 TCCATGTGCACAGCCCAGCGGGG - Intergenic
1085300546 11:75455876-75455898 GCTTTGGGCCCAGCCCTGAGGGG + Intronic
1087660294 11:100980056-100980078 GTTTTGTTCAAAGCCCAGTAAGG + Intronic
1089384516 11:118059059-118059081 GCTGTGTGCAGACGCCAGTGTGG - Intergenic
1090309665 11:125724044-125724066 ACTTTGTGCACAGCACTGAGGGG + Intergenic
1090455471 11:126844959-126844981 GCATTGTGCACAGCAGGGTGGGG - Intronic
1090990806 11:131815406-131815428 TCTTTGCGCACAGCCCAGCTAGG - Intronic
1202808030 11_KI270721v1_random:15245-15267 GCTATGAGCACAGCCCGGTGCGG - Intergenic
1092696204 12:11174312-11174334 GCCTAGAGCACTGCCCAGTGCGG + Intergenic
1094616184 12:32038490-32038512 GCTCTGTGCCCAGCCCAGGCTGG + Intergenic
1094807854 12:34108621-34108643 GCTCTGTGCACAGCGAGGTGGGG + Intergenic
1096446448 12:51697133-51697155 TCTTTCTGCACAGCCCTGTGAGG + Intronic
1098920716 12:76299771-76299793 GGTCTGGTCACAGCCCAGTGTGG - Intergenic
1099084797 12:78232422-78232444 GCTGTGTGGCCAGCTCAGTGGGG - Intergenic
1104464467 12:128979294-128979316 GCTCTGGGCACAGCCCAGGTGGG + Intronic
1106881552 13:34137426-34137448 GCTTGGTCCACAGGCCTGTGTGG + Intergenic
1107388959 13:39943227-39943249 ACTTAGAGCACAGCCCAGTTTGG - Intergenic
1109934722 13:69265583-69265605 GCTTTGTGTACATCCCAGATAGG + Intergenic
1111091453 13:83452724-83452746 GCTCTGTGGGCAGCTCAGTGTGG + Intergenic
1111963294 13:94834633-94834655 GTTGTGCGCACAGGCCAGTGGGG + Intergenic
1113711104 13:112466223-112466245 GCTTTCTGCACACTTCAGTGTGG - Intergenic
1117690308 14:58299078-58299100 ACTTTTTGTACAGCCCAGAGAGG - Intronic
1120856221 14:89214743-89214765 GTTTTTTTCTCAGCCCAGTGGGG + Intronic
1121665030 14:95665765-95665787 GCTTTGTCCACAGTCCAGGGTGG - Intergenic
1122299211 14:100722560-100722582 GCTCTCTGCCCAGCCCAGCGGGG - Intergenic
1122447588 14:101781182-101781204 GGTTCGTGGACAGCCCGGTGGGG - Intronic
1122462440 14:101906819-101906841 GGTCTCTGCAGAGCCCAGTGGGG + Intronic
1123105986 14:105841282-105841304 GCTCTGTGCAGAGCCCCGGGCGG - Intergenic
1128716538 15:69912701-69912723 GCTTTGTGCACATCCCAGCTAGG - Intergenic
1129830483 15:78666633-78666655 ACTTTGTGCACAGGCCAAAGGGG + Intronic
1129939802 15:79485568-79485590 GCTATGTGAACATCCCAGTTAGG + Intergenic
1130768180 15:86894648-86894670 CCTTTGTGCCCAGGGCAGTGTGG - Intronic
1130847780 15:87763348-87763370 GTTTTGTGCACAGCACCATGGGG - Intergenic
1131739557 15:95373024-95373046 GCTTTGTGCACTGTTCAGGGAGG + Intergenic
1132125881 15:99223778-99223800 GGTTTTTGCAGAGCTCAGTGGGG - Intronic
1133949663 16:10380331-10380353 TCTTGTTGCACAGCCCAGGGTGG - Intronic
1135330292 16:21554802-21554824 GCTTGGTCCCCAGCCCAGGGTGG - Intergenic
1135937479 16:26793408-26793430 GCTCTGCTCACAGCCTAGTGAGG + Intergenic
1136345667 16:29674172-29674194 CCTGTGTGCTCAGCCCAGTCTGG + Intronic
1137696420 16:50465012-50465034 GCTTTGTCCACACCGCAGTGGGG + Intergenic
1139295068 16:65893612-65893634 CCTTTGTGGACAACCAAGTGAGG + Intergenic
1139847697 16:69932410-69932432 GCTTAATGTCCAGCCCAGTGGGG - Intronic
1139959127 16:70707680-70707702 GCTTTCTGAACTGCCCAGGGTGG + Intronic
1140126626 16:72123615-72123637 TCTTTGGGCACAGACCACTGGGG + Exonic
1140304781 16:73792867-73792889 GCTTTGTTCACAGCAGAGAGGGG - Intergenic
1140924282 16:79567646-79567668 GCCTTGTGCCAAGCCCAGTGGGG - Intergenic
1142043330 16:87909334-87909356 GCTTGGTCCCCAGCCCAGGGTGG - Intronic
1142062439 16:88039289-88039311 GCTTTGTGCTCACTCCACTGGGG + Intronic
1142156595 16:88535232-88535254 GCTGTGTACACAGGCCACTGCGG + Exonic
1142201288 16:88762256-88762278 GCTGTGTGCAAAGGCCAGCGGGG - Intronic
1142227562 16:88885028-88885050 GCTTGGTGAGCAGCCCGGTGGGG - Exonic
1143681870 17:8481828-8481850 GCTGGCTGCACAGACCAGTGCGG + Intronic
1144669796 17:17126540-17126562 CCTTTGTGCCCATCCCAGGGAGG - Intronic
1144738403 17:17567659-17567681 GCTGTGAGCACAGCCCAGACAGG + Intronic
1148147024 17:45372492-45372514 GCCTTGTGTGCAGCCCCGTGAGG - Intergenic
1148200974 17:45749868-45749890 GCTGTGTGCCCGGACCAGTGAGG + Intergenic
1151875782 17:76867635-76867657 GCTTTGGGCACTTCCCAGGGTGG + Intergenic
1152022274 17:77786441-77786463 GCTTTTTGCACAGACCCTTGAGG - Intergenic
1152674303 17:81629827-81629849 GGTTACTGCACAGCCTAGTGAGG + Intronic
1152697599 17:81804601-81804623 GCTTTGTGCGCTCCCCAGGGCGG - Intronic
1153445347 18:5165883-5165905 ACTTTATTCTCAGCCCAGTGTGG - Intronic
1155428992 18:25735889-25735911 GCTTTGTGGAGACCCCACTGCGG - Intergenic
1156520698 18:37720233-37720255 GCTTCCTCCACAGCCCATTGGGG + Intergenic
1158706115 18:59793828-59793850 GCTTTTCCCACAGCCCAGTTTGG + Intergenic
1160529431 18:79554953-79554975 GCTTGGTCCACGGCCCAGGGAGG + Intergenic
1161582998 19:5090906-5090928 GTCCTGTGCACAGCCCGGTGGGG + Intronic
1161650634 19:5482268-5482290 ACATTGTGAACAGCCCAGGGTGG - Intergenic
1165151286 19:33761940-33761962 GTTGTGTGCACATCCCTGTGTGG - Intronic
1165384407 19:35502003-35502025 GCTTTGTGCAATCCCGAGTGGGG - Intronic
1165757203 19:38300783-38300805 GCTTTGTGCACCACCCAGAATGG - Intronic
1167721481 19:51182990-51183012 CCTGTGAGCACAGCCCGGTGTGG - Intergenic
1167763496 19:51463780-51463802 CCTGTGAGCACAGCCCGGTGTGG + Intergenic
1168719802 19:58548727-58548749 GCTTTGTTCACAGCCCATGGAGG + Exonic
925455396 2:4012268-4012290 TTTAGGTGCACAGCCCAGTGAGG + Intergenic
925921768 2:8643381-8643403 GCTATGTGCAGAGTCAAGTGAGG - Intergenic
927026447 2:19073554-19073576 GATGTGTGCACAGCCCAGGGAGG - Intergenic
931081127 2:58772386-58772408 GCATTGTGCAGAGCCCCATGAGG + Intergenic
931678961 2:64727052-64727074 ACTCTGTGCAAAGCCCTGTGTGG - Intronic
932468463 2:71938936-71938958 GGTGTGTGGAGAGCCCAGTGTGG - Intergenic
932715755 2:74100043-74100065 ACTCTGTGCCCAGCCCAGTCGGG - Intronic
933293335 2:80461942-80461964 GCTTTGTGCTCAGCCCCCTGGGG + Intronic
933771370 2:85746506-85746528 GGTGTGGGCAGAGCCCAGTGAGG - Intergenic
934056856 2:88258456-88258478 GACTTGTTCACAGCCCAGGGAGG + Intergenic
934560066 2:95308561-95308583 GCAGTGTGCAGAGACCAGTGGGG + Intronic
935485961 2:103654574-103654596 GCTTTCTGGACAGGGCAGTGTGG + Intergenic
935690942 2:105732105-105732127 GCTTTGTGCAGACCCCAGGCTGG + Intergenic
935706317 2:105860576-105860598 GTCCTGTGCACAGCCCAGTAAGG - Intronic
937286641 2:120758277-120758299 GCTTTGTGCACAGCTGAGCGTGG + Intronic
939490257 2:142868386-142868408 GCTCTGCGCACAGCCCATAGTGG + Intergenic
940188934 2:151018075-151018097 GCTGTGTGCAGAGGCCAATGTGG - Intronic
940763257 2:157761756-157761778 GCTTTCTTCACTGGCCAGTGGGG + Intronic
942147133 2:173038003-173038025 GCTTATTGCAAAGCCCAGTCTGG + Intronic
1168912032 20:1455931-1455953 GCCTATTGCAAAGCCCAGTGTGG - Intronic
1170022478 20:11851681-11851703 GCTCTGGGCATAGCCCTGTGTGG - Intergenic
1172052147 20:32126175-32126197 GCTTTGTTCTCAGTGCAGTGAGG - Intronic
1173826408 20:46050594-46050616 TCAGTGTGAACAGCCCAGTGAGG - Intronic
1173900637 20:46585919-46585941 GGATTGTGCACTGCCCAGTATGG + Intronic
1174454582 20:50640240-50640262 GCTTTGTGCACATCCTAGGCTGG - Intronic
1174472215 20:50769481-50769503 GCTTTGTGCACATCCTAGGCTGG + Intergenic
1180231826 21:46430966-46430988 GCCTTGTGCACAGACCTCTGAGG - Intronic
1180916075 22:19488294-19488316 AATTTGGGCAGAGCCCAGTGAGG + Intronic
1181107422 22:20583398-20583420 GCTTTGCCCACAGCCCACGGAGG + Intronic
1182668082 22:31973500-31973522 GCTGTGTGTTCAGCCCAGTGGGG + Intergenic
950125672 3:10508411-10508433 GATGTGGTCACAGCCCAGTGAGG - Intronic
950192237 3:10985351-10985373 GCCTTGTGCCCAGCCAAATGTGG - Intergenic
950234401 3:11306238-11306260 GTTTTGTGCAGAGCCCTGTTTGG + Intronic
950542564 3:13621044-13621066 CCTTTGGGCCCAGCCCTGTGAGG + Intronic
950612718 3:14136669-14136691 GCTGTGGCCACAGCCCAGAGCGG + Intronic
953613786 3:44471438-44471460 ACTTTGTGCACAGGGTAGTGGGG - Intronic
956381736 3:68671261-68671283 GCTTTGTGCACAGTGCATTCTGG - Intergenic
956814409 3:72894844-72894866 GATGACTGCACAGCCCAGTGGGG - Intronic
957272543 3:78050631-78050653 ACTTTGGGCAGAGCTCAGTGGGG - Intergenic
961364935 3:126393818-126393840 CCCTTGTGCAAAGCCCACTGTGG + Intergenic
961455179 3:127020477-127020499 GCTCTGGGCTCAGCCAAGTGGGG + Intronic
967301320 3:188016886-188016908 AGTTTGAGGACAGCCCAGTGAGG + Intergenic
968562737 4:1293537-1293559 GGTGTCTGCACAGCCCAGGGCGG + Intronic
968753612 4:2403112-2403134 GCTTGGGCCACAGCCCAGAGGGG - Intronic
968818718 4:2834778-2834800 GCTGAGTTCACAGCCCAGTCTGG + Exonic
968934787 4:3604380-3604402 CCTTGGTGCCCAGCACAGTGTGG - Intergenic
969688722 4:8691552-8691574 GATTTGTGCACTTCACAGTGCGG - Intergenic
970478519 4:16449923-16449945 GCTTTGTTCAAAGCCTGGTGGGG + Intergenic
971640580 4:29127100-29127122 GATTTGTGCACAGAGCAGTGGGG - Intergenic
974954049 4:68616953-68616975 CCCCTGTGCCCAGCCCAGTGTGG + Intronic
976780687 4:88755333-88755355 GCTAAGTGCACAGCACAGTATGG - Intronic
978596149 4:110379462-110379484 GCTTTCAGCGCAGCCCAGAGGGG + Intronic
985531127 5:434380-434402 GCTGTGTGCCCAGCCAGGTGTGG + Exonic
985619963 5:948998-949020 GCTTTGAGGAAAGCCCAGTGAGG + Intergenic
985632078 5:1018973-1018995 CCTCTGTCCACAGCCCAGTCTGG + Intronic
985942843 5:3152223-3152245 GCGTTGGACACAGCCCTGTGAGG + Intergenic
986789975 5:11150070-11150092 CCTTCCTGCACAGCCCCGTGGGG - Intronic
991979051 5:72212627-72212649 GGTTGGGGCAAAGCCCAGTGTGG + Intergenic
994976666 5:106816522-106816544 TCTCTGTCCACAGCCCAGAGAGG - Intergenic
996760153 5:126978789-126978811 ACTGTGTGACCAGCCCAGTGAGG + Intronic
997696863 5:135867995-135868017 GTTTTGTTTACAGCCCAGTTAGG - Intronic
999734730 5:154504553-154504575 CCATTGTTAACAGCCCAGTGGGG - Intergenic
1001949771 5:175808100-175808122 CCTTGGTGCCCCGCCCAGTGGGG + Intronic
1002193078 5:177488999-177489021 CCTCTGTGCACTGCCCCGTGGGG - Intronic
1003311768 6:4975152-4975174 GCTTTGTGCACAGGGCTTTGTGG - Intergenic
1004036133 6:11925963-11925985 GCTTAGTGGGCAGCCTAGTGGGG - Intergenic
1004339465 6:14795526-14795548 GAGTTGTGCAGAGGCCAGTGAGG - Intergenic
1004558872 6:16728260-16728282 GCTGTGCGCACAGGGCAGTGGGG + Intronic
1007755703 6:44097896-44097918 GCTGTGTGCAGAGGCCAGGGAGG - Intergenic
1010056879 6:71576787-71576809 GCTTTGTGGACATCTCTGTGTGG - Intergenic
1010298893 6:74234981-74235003 GTTTTTTGTATAGCCCAGTGAGG + Intergenic
1010760000 6:79711737-79711759 GGTTTGGCCACAGCACAGTGAGG - Intergenic
1011226004 6:85108004-85108026 GCTGTTAGCACAGCCCAGAGGGG + Intergenic
1011260931 6:85468923-85468945 GCATTTTGCAGGGCCCAGTGTGG + Intronic
1013661905 6:112306620-112306642 GCTCTGTGCCCAGCACAGTGAGG - Intergenic
1015071674 6:129101697-129101719 GCTTTCTGCCCAATCCAGTGTGG - Intronic
1015772440 6:136783160-136783182 GCTTTGAGCACAGCCAAGCCTGG - Intronic
1017121714 6:151030273-151030295 CCTTTGTGCAGAGCCCATGGAGG + Intronic
1018393824 6:163361821-163361843 GACCTGTGCACAGGCCAGTGGGG - Intergenic
1018702663 6:166439585-166439607 TCTGTGTGCACGGCCCTGTGAGG - Intronic
1019171722 6:170136657-170136679 GCTTTGTGCCCAGCCCTGCGCGG - Intergenic
1019444642 7:1065019-1065041 GCTTTCTGCAGAGCCCCTTGGGG + Intronic
1019642098 7:2109022-2109044 GCTGTGTGCGCAGCACAGGGAGG - Intronic
1021279434 7:18699209-18699231 GCTTTGTGCACAGTCAATAGAGG + Intronic
1021387273 7:20046383-20046405 GATTTCTCCAAAGCCCAGTGGGG - Intergenic
1022143388 7:27513018-27513040 TGTTAGTGCTCAGCCCAGTGGGG - Intergenic
1029601233 7:101564679-101564701 GCTTTGGGCTCAGCCAAGGGTGG + Intergenic
1030198008 7:106871926-106871948 GCTCTGTACACACCACAGTGTGG + Intronic
1034438229 7:151073860-151073882 GCTGTGAGCACAGGGCAGTGTGG - Intronic
1039898561 8:41734115-41734137 GCTTTCTGCACGTCCCAGTGGGG + Intronic
1041960119 8:63605274-63605296 GCTTTGTGCACCTGCCAGTTTGG + Intergenic
1045054942 8:98360814-98360836 GCTTTGTTAACAGGCCAGTTGGG + Intergenic
1048318809 8:133382534-133382556 TGTTTGTGCAGAGCCCAGCGTGG + Intergenic
1048335999 8:133502790-133502812 TCTGTCTGCAGAGCCCAGTGTGG + Intronic
1048443578 8:134477410-134477432 GCTCTGTGCACAGCATTGTGGGG - Intergenic
1049164614 8:141118205-141118227 TCTTTGTGAACACCCCAGTAGGG - Intronic
1049593223 8:143471981-143472003 GGGCTGTGCAGAGCCCAGTGAGG - Intronic
1049666911 8:143849004-143849026 GCTGTGTCCACAGGCCACTGTGG + Intergenic
1051425024 9:16924365-16924387 GCTCTGCCCACAGCCCGGTGCGG - Intergenic
1053149833 9:35736405-35736427 GCTTCGTGCCCTCCCCAGTGAGG + Exonic
1054455386 9:65427598-65427620 CCTTGGTGCCCAGCACAGTGTGG + Intergenic
1055199271 9:73638943-73638965 GAATTGTGCTAAGCCCAGTGAGG + Intergenic
1056491602 9:87113182-87113204 GCTTCTTTCTCAGCCCAGTGGGG + Intergenic
1057309717 9:93934287-93934309 GCTTTTTGCACACCGCACTGTGG - Intergenic
1057559802 9:96118237-96118259 GCCTAGTTCACAGCCAAGTGAGG - Intergenic
1062110029 9:134777267-134777289 GATGTGCGCACAGCCCAGAGAGG - Intronic
1186645108 X:11498541-11498563 ACTATGTGCTCAGTCCAGTGGGG + Intronic
1189717497 X:43881543-43881565 GGTATGTACACAGCCCCGTGTGG + Intronic
1190744812 X:53316171-53316193 GCTGTGTGCACAGCGCAGGAGGG - Intronic
1195702179 X:107713957-107713979 GCTTTGTGCACAGCCCAGTGTGG - Exonic
1196102992 X:111866955-111866977 GCTCTGTGCCCAGCTCCGTGTGG + Intronic
1196532757 X:116808668-116808690 GATTTCAGCAGAGCCCAGTGGGG - Intergenic
1198133537 X:133724070-133724092 GCTTTGTAACCAGCCCTGTGAGG + Intronic
1198532171 X:137558072-137558094 GGCCTCTGCACAGCCCAGTGTGG + Intergenic
1200862224 Y:8004992-8005014 CCTTTGTGCACGGCCCATTCTGG + Intergenic