ID: 1195702675

View in Genome Browser
Species Human (GRCh38)
Location X:107716648-107716670
Sequence CGCCCCGGCTCGGGAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195702669_1195702675 -9 Left 1195702669 X:107716634-107716656 CCAGCTCCGGCCGGCGCCCCGGC 0: 1
1: 0
2: 3
3: 56
4: 708
Right 1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 214
1195702660_1195702675 30 Left 1195702660 X:107716595-107716617 CCGGCGGCACACAGCTCGCTCAG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 214
1195702666_1195702675 -3 Left 1195702666 X:107716628-107716650 CCTAGCCCAGCTCCGGCCGGCGC 0: 1
1: 1
2: 2
3: 40
4: 419
Right 1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 214
1195702663_1195702675 4 Left 1195702663 X:107716621-107716643 CCGGGCTCCTAGCCCAGCTCCGG 0: 1
1: 0
2: 2
3: 37
4: 437
Right 1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 214
1195702667_1195702675 -8 Left 1195702667 X:107716633-107716655 CCCAGCTCCGGCCGGCGCCCCGG 0: 1
1: 0
2: 4
3: 24
4: 300
Right 1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG 0: 1
1: 0
2: 2
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195702675 Original CRISPR CGCCCCGGCTCGGGAGGCGC CGG Intronic
900460587 1:2800656-2800678 GGCCCAGGCTCGGGGGGCGGCGG - Intronic
901068928 1:6507760-6507782 CGTGCCGGCGCGGGAGGGGCCGG - Intronic
901084607 1:6602908-6602930 CGCCGCGGCTCTCGAGGGGCGGG + Intronic
901373262 1:8818048-8818070 CGGCCCAGCCCGGGGGGCGCGGG - Intergenic
901510502 1:9716024-9716046 GGGCCCGGTTCGGGAGCCGCAGG - Exonic
901526081 1:9824080-9824102 CGCGCGGGCCCGGGAGGGGCGGG + Exonic
902586177 1:17439744-17439766 CGCGGCGGGGCGGGAGGCGCGGG + Intergenic
902770427 1:18642717-18642739 GGCCCCGGCTGGGGTGGAGCAGG + Intronic
903142149 1:21345269-21345291 CGCCCTGGCTCGCGGGGGGCTGG - Intronic
903830130 1:26169720-26169742 GGCCCTCGCTGGGGAGGCGCGGG - Intergenic
904237051 1:29122823-29122845 CGGCCCGGATCCCGAGGCGCAGG - Intronic
905137129 1:35808363-35808385 GGGCCCGGAGCGGGAGGCGCCGG + Exonic
905643806 1:39610335-39610357 GACCCCGCCTGGGGAGGCGCAGG - Intergenic
906673634 1:47677680-47677702 CGCCCCAGCCCAGGAGCCGCAGG + Intergenic
907444739 1:54500224-54500246 CGCCCTGGCTCGGGGAGCGGGGG + Intergenic
907896829 1:58700153-58700175 CCTCCCGGCACGGGAGGGGCCGG - Intergenic
912486709 1:110034843-110034865 CGCACCGGGTCGGGCGGCGCCGG + Intronic
913131013 1:115838569-115838591 CGCCCTGGCGCGGGAGCCGGCGG + Exonic
913161824 1:116152167-116152189 CGCCGCGGCTCGGAAGCGGCAGG + Intergenic
915167777 1:153958204-153958226 CGCCGCCGTTTGGGAGGCGCAGG - Intronic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
916656809 1:166884132-166884154 CTCACCGGCTCTGGCGGCGCGGG + Intergenic
916716996 1:167455004-167455026 GGCCCCGGCTCGGGGAGCTCCGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920184596 1:204152089-204152111 CGCCCCGGCCCGCGGGCCGCTGG + Intergenic
920331839 1:205214211-205214233 CGCTCAGGCTTGGGAGGCGGAGG + Intergenic
1065844753 10:29735648-29735670 TGCTCCGGGGCGGGAGGCGCGGG - Intronic
1069024189 10:63521854-63521876 CGCCCCTGCTCCGGCGGCGCTGG + Intronic
1071858005 10:89645151-89645173 AGCCCCGGCTGGGGGTGCGCGGG - Exonic
1073111899 10:101067454-101067476 AGCCTCGGCTTGGGAGGAGCTGG - Intronic
1076531460 10:131147841-131147863 CGCACAGGTTCGGGAGGAGCTGG + Intronic
1077196030 11:1280654-1280676 GGGCCAGGCTGGGGAGGCGCCGG + Intronic
1078066296 11:8081394-8081416 CGCCCCGGCCCGGGAGGATGCGG + Intronic
1078771672 11:14358268-14358290 AGCTCCGGCTCAGGCGGCGCGGG + Intronic
1080283773 11:30586013-30586035 CGCCCCGGGAAGGGAGGCGGAGG - Intronic
1080387314 11:31817764-31817786 CGGCCCGGCTCGGGGCCCGCGGG - Intronic
1080601976 11:33829335-33829357 CCCCCCGCCTTGGGAGGCGCTGG - Intergenic
1080612435 11:33916125-33916147 CGCCCTGGCTCAGGAAGCTCTGG + Intergenic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1085475202 11:76784597-76784619 CCGCCCGGCTCCAGAGGCGCGGG - Intronic
1087046963 11:93850511-93850533 CACCCCGGCCCGCGAGGCCCCGG - Exonic
1089243192 11:117098637-117098659 GGCCCCGGTTCCTGAGGCGCTGG + Intergenic
1089244748 11:117110711-117110733 CTGCCCGGGGCGGGAGGCGCCGG + Intergenic
1090977174 11:131688176-131688198 CCTCGCGGCTCGGGGGGCGCGGG - Intronic
1092108975 12:5945524-5945546 TGCCCCGGCTCTGGGGGAGCAGG - Intronic
1094375273 12:29783237-29783259 CGGGGCGGTTCGGGAGGCGCCGG - Intronic
1095261765 12:40106048-40106070 AGCGCCAGCTCGGCAGGCGCGGG - Intronic
1097284235 12:57865373-57865395 CGCTCCGGCGGGGGAAGCGCGGG - Intergenic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1101660238 12:106759109-106759131 GGCCCCGGCCCGAGAGGCACAGG + Intronic
1102571085 12:113827459-113827481 CGGCCCTGCATGGGAGGCGCAGG + Intronic
1102962109 12:117099521-117099543 CGCCCCGGCCCGGAAACCGCCGG + Intergenic
1103331629 12:120158360-120158382 CCCCCAGGCTCAGGAGGCCCTGG + Intronic
1103336544 12:120194494-120194516 TGGCCCGGCCCGGGCGGCGCAGG - Intronic
1104837219 12:131799475-131799497 GGCCCCGTCTCAGGAAGCGCTGG - Exonic
1107779252 13:43880096-43880118 CGCCTCGGCTCACGGGGCGCAGG - Intronic
1110318585 13:74135515-74135537 CGCGGCGGCTCGGAGGGCGCGGG + Intergenic
1110450901 13:75636519-75636541 CGCTCCGGCTGCGAAGGCGCCGG - Intronic
1113231608 13:108218464-108218486 GGCCCCCGCTCGGGTGTCGCCGG - Exonic
1114267371 14:21080881-21080903 GGCCCAGGCACGGGAGGCCCTGG + Exonic
1117377408 14:55129180-55129202 CGCCCCGCCTCGGGAGAGGCGGG + Exonic
1119764798 14:77181677-77181699 GGCCCCTGCTTGGGAGGAGCCGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1124469367 15:29969097-29969119 GGCCCCCGCTCCGGAGCCGCTGG + Intergenic
1125731029 15:41892953-41892975 GGCCCCGGCTCGGGGGTGGCAGG + Exonic
1128119198 15:65133435-65133457 GGCCCCGGGCCGGGAGGCGGTGG + Exonic
1128322619 15:66703680-66703702 CGCCCCGGCCAGGGGGTCGCTGG - Exonic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1129082174 15:73051689-73051711 CGGCCCGGCTTGGGAGCCGGAGG + Exonic
1132055863 15:98649777-98649799 CCCCCGGGCTCGGGAGCGGCGGG + Intronic
1132482219 16:172475-172497 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132483067 16:176279-176301 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132560223 16:590123-590145 CGCCCGGGCGCGGGCGGGGCGGG + Intronic
1132642675 16:984925-984947 TGGCCCGGCTCGGGTGGGGCGGG - Exonic
1132723509 16:1328306-1328328 AGCCCAGGCTCGGGAGGCCGAGG - Intergenic
1132743884 16:1428800-1428822 CTCCCCGGGTCGGGAGGGCCAGG + Intergenic
1132774256 16:1583164-1583186 AGCCCTGGCTCTGGAAGCGCAGG + Intronic
1138016707 16:53434842-53434864 CGACGCGGCTCGGAAGGCACCGG - Intronic
1138381871 16:56608343-56608365 CGCCTCGGCGCGGAAGGGGCTGG - Exonic
1139364921 16:66427292-66427314 CGCTCGGGCTCGGGCGTCGCGGG - Exonic
1142132350 16:88436833-88436855 CGCCCAGGCTGCGGAAGCGCTGG - Exonic
1142261279 16:89043553-89043575 TGCCCCAGCCCGGGAGGTGCTGG - Intergenic
1142393252 16:89816345-89816367 CGCCCAGGCGCAGGAGGGGCCGG + Intronic
1143639975 17:8190175-8190197 CGCCCCGGCTCCGGAGGCAGTGG + Exonic
1144756355 17:17682423-17682445 CGGCCAGGCCCGGGAGGCACGGG + Intronic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1150561854 17:66302080-66302102 CGGCCCGGCACGGGTGGCGCAGG + Intergenic
1151370695 17:73644745-73644767 CGCGCCGAATCGGGAGACGCCGG + Intergenic
1151464216 17:74274217-74274239 CGGCCTGGCTCCGGACGCGCGGG - Intergenic
1152132370 17:78485062-78485084 GGCTCTGGCTCAGGAGGCGCAGG - Intronic
1152617881 17:81346143-81346165 GGCCCGGGACCGGGAGGCGCGGG - Intergenic
1152628126 17:81397580-81397602 CTCCGGGGCTCGGGAGGCGCCGG + Intronic
1152988874 18:344203-344225 TGCCCCAGCTCTGGAGGGGCTGG - Intronic
1153872751 18:9335176-9335198 CACCCCGGCTCGGCCGACGCGGG - Intronic
1154012674 18:10589205-10589227 GGCCCCGGGCCGGGAGGCGATGG + Intergenic
1154070814 18:11149711-11149733 CTCCCAGGCGCGGGAGCCGCGGG - Intergenic
1154202393 18:12308410-12308432 CGCCCCGGCGGGGGTCGCGCCGG - Intronic
1155971930 18:32091793-32091815 CGCCCCGCCTCGCTAGGCCCGGG - Intergenic
1157095114 18:44680232-44680254 CGCCCTAGCTCGGGGGGCGCCGG - Intronic
1160204465 18:76822175-76822197 CGCCCGGGCCACGGAGGCGCGGG + Exonic
1160518935 18:79493606-79493628 AGCTCCGGCTCAGGAGGGGCGGG - Intronic
1160703301 19:518227-518249 GGCCCCGGCTGGGTAGGGGCTGG + Intronic
1160835356 19:1122313-1122335 GGCCCCGGCTCAGCAGGCTCTGG + Intronic
1160865437 19:1253957-1253979 CGGCCCGGCCCGGGCGCCGCTGG - Intronic
1161175809 19:2841672-2841694 GGCCCCGGCGAGGGCGGCGCAGG + Intronic
1161210294 19:3062241-3062263 CGCCCCGGCTCGGGCTGCTGGGG + Intronic
1161574502 19:5048180-5048202 TGCCCCTGCCCGGGAGGTGCCGG + Intronic
1161683080 19:5690244-5690266 CTACTCGGCTCAGGAGGCGCAGG - Exonic
1161766697 19:6212519-6212541 CTCCCCGGCTCGCGCTGCGCTGG - Intergenic
1162031187 19:7917899-7917921 CGCCCCGGGTCCCGACGCGCGGG - Intronic
1162341828 19:10095995-10096017 CGCCTGTGCCCGGGAGGCGCGGG - Exonic
1162398365 19:10430811-10430833 GGCCCCGCCTCGGCGGGCGCTGG - Intronic
1162426896 19:10602477-10602499 CGCCCGGGCTGGGGTCGCGCTGG + Intronic
1164639069 19:29811806-29811828 GGCGCCGGCCCGCGAGGCGCAGG - Intergenic
1165104814 19:33462486-33462508 CGCCACGGCTGGGCAGCCGCCGG + Intronic
1165256669 19:34580449-34580471 CGACCCGGCTGTGGAGGAGCTGG + Intergenic
1165493620 19:36139880-36139902 CGCCCTGACTCGGTAGGCGGGGG - Exonic
1165744533 19:38222793-38222815 CGCCCAGGCTCGGGAGGGGTGGG + Intronic
1166800088 19:45451232-45451254 AGCCACAGCGCGGGAGGCGCTGG - Intronic
1168078155 19:53991726-53991748 GGCCCCTGCTCGGGAGTCGGGGG + Intergenic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
925375285 2:3379733-3379755 CGCCGCGGCCCGGCACGCGCAGG + Exonic
925725275 2:6865634-6865656 GGCCGCTGCTCGGGCGGCGCGGG - Exonic
926320513 2:11745994-11746016 CCTCCCGGCTGGAGAGGCGCAGG + Intronic
927772845 2:25878550-25878572 CGGCCGGGCTTGGGAGGCGGGGG - Intergenic
931517776 2:63059785-63059807 CGCCGCGGCCCGGCAGGCCCTGG - Intergenic
932780114 2:74554315-74554337 CAGCCCGGCTCGGGCGGGGCTGG + Exonic
933772605 2:85753829-85753851 GGCCCGGGCTGGGGAGGCGGTGG + Intronic
933910314 2:86934919-86934941 CGCCCGAACTCGGGAGGCGGAGG - Intronic
934022413 2:87968490-87968512 CGCCCGAACTCGGGAGGCGGAGG + Intergenic
936413876 2:112286519-112286541 CGCCCGAACTCGGGAGGCGGAGG - Intronic
944451689 2:199850681-199850703 CTCCGCGGGTGGGGAGGCGCGGG - Intronic
946394097 2:219434767-219434789 CCCCCCGGCTCGGGTTGCGAGGG - Intergenic
947992337 2:234497252-234497274 CGGCGCGGCGCGGGAGGGGCCGG - Intergenic
948645206 2:239400372-239400394 CCCACCTGCTCGGGGGGCGCGGG + Exonic
1169214740 20:3786525-3786547 CGCCCCGGGGCGGGGGGCCCGGG + Exonic
1170026111 20:11891134-11891156 CCCCCGGGCTCGAGAGGCGCTGG + Intronic
1172408210 20:34704562-34704584 GGCCCGGGCGCGGGGGGCGCAGG - Intronic
1175267118 20:57709698-57709720 CGCCCCGGCTCGCCGGGCTCGGG + Exonic
1175975563 20:62708846-62708868 CAGCCCGGCTCGGGCTGCGCGGG - Exonic
1176005619 20:62861036-62861058 CCGCCCGGCTCGGGGGGCTCGGG + Exonic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1181147409 22:20858722-20858744 CGCCGCGGCTCGTGAGGTGATGG - Exonic
1181585239 22:23849469-23849491 CGCACCGGGGCGGGTGGCGCAGG + Intergenic
1182808579 22:33096678-33096700 CCCACCTGCTCGGGAGGCGGAGG - Intergenic
1183903355 22:41022229-41022251 GGCCCGGGCGCGGGAGCCGCGGG - Intergenic
1184158377 22:42683773-42683795 GGCCCGGGCTCTGCAGGCGCTGG - Intergenic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1185088122 22:48751714-48751736 TGCCCCGGCTCCGGCGGCCCGGG + Intronic
1185382467 22:50516334-50516356 CTGCCCGTCTCGGGAGGTGCTGG + Intronic
950043248 3:9933525-9933547 CGTCCCGGCGCGGGAGTCCCCGG - Exonic
950829530 3:15859968-15859990 GGCCGCGGCTCGGGCGGGGCGGG + Intergenic
952301384 3:32106933-32106955 GGCACTCGCTCGGGAGGCGCTGG + Intronic
956675031 3:71725316-71725338 CGCCGGGGCCCGGGAGCCGCCGG - Exonic
960101334 3:113746252-113746274 CGCGCCGGCGCGCGAGGGGCGGG - Exonic
960925930 3:122795034-122795056 CGGCCCGGCTCGGGCCGCGCAGG + Exonic
963133333 3:141877292-141877314 CGCTCCGGCCCGAGAGGCCCTGG + Intronic
967272659 3:187743927-187743949 GGACCCGGCGCGGGAGGAGCGGG - Intronic
968514245 4:1009754-1009776 CGTGCCGGCGCGGGAGGCCCGGG + Intergenic
968572019 4:1346970-1346992 CACCCCAGCCCAGGAGGCGCAGG - Intergenic
968651855 4:1763323-1763345 CGGCCGGGCTGGGGAGGGGCCGG + Intergenic
968907943 4:3463231-3463253 CGCGCCGGCCCTGGAGTCGCCGG + Intergenic
969330317 4:6470922-6470944 CGCCCTGGCCCGGGAGGCAGAGG - Intronic
970202863 4:13627463-13627485 GGCCCCGGCGCGGGCGGGGCGGG - Exonic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
984706060 4:182848114-182848136 CACCCAGGCTGTGGAGGCGCAGG - Intergenic
985451305 4:190065369-190065391 CGCCCCGGCTCCGGAGGAGCCGG - Intergenic
985467697 5:12980-13002 CGCCCCCGCCGGGGACGCGCCGG - Intergenic
985515824 5:344098-344120 AGCTCCGGCGCGGGCGGCGCAGG + Intronic
986737461 5:10678705-10678727 AGCCCCGGCTTGGGAGTGGCTGG - Intergenic
988796373 5:34656549-34656571 AGCTCGGGCGCGGGAGGCGCTGG + Intronic
990553693 5:56909563-56909585 CGCCCCGGCCCGGGAGGAGAGGG - Exonic
991913914 5:71587463-71587485 CGGCCCGGCGGGAGAGGCGCGGG - Exonic
997984598 5:138492335-138492357 TGGCCCGGCGCGGGAGGCGCGGG + Intergenic
998192945 5:140042589-140042611 CGCCTCGGGTCGGGTGGCGTTGG - Exonic
998321891 5:141240515-141240537 AGCCCTGGATCGGGAGGAGCAGG + Intergenic
998350196 5:141495300-141495322 AGCCTCGGCTCTGGAGGCTCTGG - Intronic
1002291078 5:178201338-178201360 CCCCCCTGCTCGGGAGGCTGAGG - Intergenic
1003177314 6:3761652-3761674 CGGGGAGGCTCGGGAGGCGCAGG - Intergenic
1003645536 6:7910650-7910672 CGCCCGGGCCCAGGAGGCGGCGG - Exonic
1004660623 6:17706398-17706420 CGCCCCGGAGCGGGAAGCGGCGG - Exonic
1004690392 6:17987836-17987858 CGCCGGGGCTCGGGAGAGGCCGG + Intergenic
1006388418 6:33745111-33745133 TGCACTGGCTGGGGAGGCGCAGG - Intronic
1006547860 6:34794074-34794096 CGCTTCAGCTCGGGAGGCGGAGG + Intronic
1007227800 6:40327219-40327241 CCCCCCTGCTCAGGAGGCCCTGG + Intergenic
1007431483 6:41779820-41779842 CCCCGCGGCCCGGGCGGCGCCGG + Exonic
1011044702 6:83068089-83068111 CGCCCCAGCAGGGGAGGCTCGGG - Intronic
1015366375 6:132401543-132401565 CGCGCCCGCCCGGGAGGGGCAGG + Exonic
1017672278 6:156778836-156778858 CGGCCCGGCGCGGGCGGCGGCGG + Exonic
1019274712 7:169943-169965 CGCCCGGGCTGAGGAGGGGCTGG - Intergenic
1019349745 7:549172-549194 CTTCCCGGCTCGGGAGGCCTTGG - Intergenic
1019577945 7:1746542-1746564 GGCCTCGGCTCGGAAGGCGCGGG - Exonic
1023177551 7:37448504-37448526 CGCCGCGGCTCGGGCGGGGGTGG - Intronic
1025770348 7:64499626-64499648 CGCGCCTGCTCGGGAGGCTGAGG + Intergenic
1027111320 7:75442290-75442312 CGCCCCCGCTCCGGAGGGCCAGG - Intronic
1027230109 7:76267586-76267608 CGTCCTGGCTCGGGAGCCGCCGG + Intronic
1027283561 7:76626849-76626871 CGCCCCCGCTCCGGAGGGCCAGG - Exonic
1029272696 7:99386366-99386388 TGCCCCAGCTGGGGAGGGGCTGG + Intronic
1029438945 7:100576969-100576991 AGCCCCTGCTTGGGAGGCACTGG + Exonic
1029927095 7:104329260-104329282 CTCCCCGGCTCGGGCGCCCCGGG - Intronic
1032090833 7:128910709-128910731 CGTCGCGGCTCAGCAGGCGCTGG + Exonic
1032194543 7:129781449-129781471 CCTCCCGGCTCGGCAGGAGCTGG - Intergenic
1033654396 7:143362878-143362900 CGCCCCGGCACGGCCGGAGCAGG - Intergenic
1034182176 7:149147568-149147590 CGTCGGGGCTCGGGACGCGCAGG - Exonic
1038267001 8:26045477-26045499 CGGCCCGGCTTGCCAGGCGCCGG - Intergenic
1038613268 8:29072175-29072197 CACCCCGGCTCCGGAGGCACAGG - Exonic
1039468034 8:37797488-37797510 AGGCCGGGCTCGGGAGGCTCCGG - Exonic
1041686684 8:60651750-60651772 CGCACGGGGCCGGGAGGCGCCGG - Intergenic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1044229538 8:89758120-89758142 CGCCGCGGCTCAGGTAGCGCAGG - Exonic
1045023566 8:98064740-98064762 AGCCCGGGCGCGGGCGGCGCCGG - Intronic
1045298648 8:100892619-100892641 CGCCCCGGTCCGGGAGGTGAGGG - Intergenic
1045510786 8:102810659-102810681 TGCCACGGCTCGGGCTGCGCCGG - Intergenic
1047961873 8:130016778-130016800 CGCCCCGGCTCGGGAGGACACGG - Intronic
1049099659 8:140569753-140569775 CTCCCAGGCCCGGGAGACGCTGG - Intronic
1049543421 8:143218642-143218664 CGCCTCAGCTGGGGAGGAGCTGG + Intergenic
1049643656 8:143726663-143726685 CGCTCCGGCACGGGGGGCACCGG + Exonic
1049643666 8:143726696-143726718 CGCTCCGGCACGGGGGGCACCGG + Exonic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1050744087 9:8857530-8857552 CGCTCTGGCTCGGGAGGCGCCGG + Intronic
1051780553 9:20684328-20684350 CACCCCTGCTCGGGAGCCGCCGG + Intronic
1052837734 9:33264425-33264447 CGCTCCGGGTCGAGCGGCGCCGG + Exonic
1053435142 9:38069229-38069251 CGCGGCGGCTCGGGAGGCGGCGG - Intergenic
1057619014 9:96619115-96619137 CGGCCCGGCCCCGGAGGCCCCGG + Intronic
1057733731 9:97633732-97633754 CGCCACGGCCCCGGAAGCGCAGG - Exonic
1059021195 9:110578982-110579004 GGGCCCGGGTCGGGAGGGGCGGG + Intronic
1059375292 9:113876325-113876347 CAGCCCGGCCCGGGAGGAGCAGG + Exonic
1060552641 9:124492826-124492848 GGCCCAGGCTTGAGAGGCGCCGG - Intronic
1061483068 9:130906648-130906670 GGCCCCAGCTCGGCTGGCGCAGG + Intronic
1062169384 9:135126531-135126553 CGCCCAGGCTCGGCAGTCCCAGG - Intergenic
1062443370 9:136583407-136583429 GGCCCAGGCTGGGGAGGCCCGGG + Intergenic
1062535421 9:137019101-137019123 CTGCCCGGCTCGGCAGGCGCAGG - Intronic
1062556740 9:137116212-137116234 CTTCCCGGCTTGGGAGGCCCTGG - Intergenic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1189262528 X:39688876-39688898 CGCCGCGGCTCTGCAGGCGCGGG + Intergenic
1189325252 X:40107715-40107737 CGCGCCGGCTCGGGCGCAGCGGG - Intronic
1195625093 X:106999527-106999549 GGCCCCGGCTCCGCAGGCGGAGG - Intronic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1198051458 X:132956673-132956695 CACCCCGGCTGGGCAGGTGCTGG - Intronic