ID: 1195703165

View in Genome Browser
Species Human (GRCh38)
Location X:107720133-107720155
Sequence TTTTCCTAAAAGCTGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195703165 Original CRISPR TTTTCCTAAAAGCTGGAATA GGG (reversed) Intronic
905457943 1:38101128-38101150 ATTTCCTAAATGCTGGCCTAAGG - Intergenic
908704975 1:66943432-66943454 TTTTACTATAATCTGGTATAAGG + Intronic
909133048 1:71763700-71763722 TTTTCCTTATAGCTTTAATATGG - Intronic
909312532 1:74171210-74171232 TTTTCCTAAGATATGGAACAAGG - Intronic
909909159 1:81239863-81239885 TTTGCATATGAGCTGGAATATGG - Intergenic
910135805 1:83967811-83967833 ATTTCCAAAACGCTGGAATGAGG + Intronic
910150629 1:84139110-84139132 TCTTCCTAAGACTTGGAATAAGG + Intronic
910818124 1:91314030-91314052 TTTTGCTAAAAGCTGGAAGTTGG - Exonic
911682794 1:100737357-100737379 TTTAATTAAAAGCTGTAATAAGG + Intronic
911782927 1:101906016-101906038 TTTTAAGAAAAGCTGTAATAGGG + Intronic
913084996 1:115428761-115428783 CTTTCATAGAAGCTGGAATATGG + Intergenic
914736596 1:150423415-150423437 TTTTACGAAAACCTGGGATAGGG - Intronic
915002597 1:152607297-152607319 TTCTCCTAATAGCTGTATTAAGG - Intergenic
916308248 1:163364116-163364138 TTTTATTAAAAGTTGGAAGAAGG - Intergenic
916704128 1:167329326-167329348 TTTTCTTAGAAGCTTTAATATGG + Intronic
917692793 1:177486452-177486474 CTTTCCTAAAACTTGGCATAGGG - Intergenic
917982916 1:180283483-180283505 TATTCCTAAATGATAGAATACGG - Intronic
918194666 1:182210064-182210086 TTTGCCTAAATGTTGAAATAGGG + Intergenic
918231876 1:182541499-182541521 TATTCACAATAGCTGGAATATGG - Intronic
919521107 1:198588785-198588807 TTTTAATAAAAGCTTCAATATGG - Intergenic
920228853 1:204457116-204457138 TTTTCGTCACAGCTGGAAGAAGG + Intronic
920560075 1:206932566-206932588 TGTTCCTCAGAGCTGGAAGAAGG + Exonic
921272602 1:213486235-213486257 TTTTAATAAATGCTGGATTAGGG - Intergenic
922314472 1:224430749-224430771 TTTTTCTAAATGCTGGAGTTTGG - Intronic
922444073 1:225681825-225681847 TTATACTAAAAACAGGAATAGGG - Intergenic
923380648 1:233414490-233414512 ATTTCCTAAATGCTGGATTTTGG + Intergenic
923593659 1:235343188-235343210 TTTTCCTAAACGCTGCTGTAAGG + Exonic
924001955 1:239563911-239563933 TTTTCATGAACACTGGAATAAGG + Intronic
1063734331 10:8735075-8735097 TTTTGCAAAGAACTGGAATATGG + Intergenic
1063825119 10:9888193-9888215 TTTTCCCAAAATCTAAAATATGG - Intergenic
1064626071 10:17262939-17262961 ATTTCCTAAAAGGGAGAATAGGG - Intergenic
1066286836 10:33975756-33975778 TTTGCCAGAAATCTGGAATAAGG - Intergenic
1066307424 10:34159582-34159604 AAGTCCTGAAAGCTGGAATATGG + Intronic
1066580589 10:36876309-36876331 TCCTCCTAAAAGCTGGACAACGG - Intergenic
1067579753 10:47435384-47435406 TTCTCCTAAGAACTGGAAAAAGG - Intergenic
1068108409 10:52649266-52649288 TTTACCTAATATCTGGTATATGG + Intergenic
1069150883 10:64958202-64958224 TTATCCTAAAAGCTTGTTTAAGG + Intergenic
1069307072 10:66983731-66983753 TTTTCCTAAAAACTGTATCATGG - Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070846788 10:79529446-79529468 TTCAAATAAAAGCTGGAATATGG - Intergenic
1070917816 10:80166279-80166301 TGTTCCTCAAATCTGGGATATGG - Intronic
1072330289 10:94342133-94342155 TTATCCTTAAAGCTGTCATAAGG - Intronic
1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG + Intronic
1073678432 10:105676212-105676234 TTCTCCTAAGATCAGGAATATGG - Intergenic
1074315436 10:112357218-112357240 ATTTCCTAGAAGATGGAATCAGG - Intergenic
1075677596 10:124306533-124306555 TTTTTCAAAAAGCAGGAAAAAGG + Intergenic
1078899316 11:15626894-15626916 TTTTTCTAAAAACTGAACTAAGG + Intergenic
1080086553 11:28289722-28289744 TTTTCCTATAAATTAGAATAGGG - Intronic
1080243973 11:30158930-30158952 TTTCTATAAAAGCTGAAATAAGG + Intergenic
1080358619 11:31485035-31485057 TTTTTTAAAAAACTGGAATAGGG - Intronic
1080714507 11:34786530-34786552 TTCTCCTAAAATTTGGATTAAGG + Intergenic
1081368645 11:42269807-42269829 TTTGTCTAAAATCTAGAATAAGG + Intergenic
1082034453 11:47633408-47633430 TTTGCTTAAAAGCAGGGATACGG - Intronic
1082131555 11:48496306-48496328 TTGTCCTGAACACTGGAATAAGG + Intergenic
1082245375 11:49915578-49915600 TTGTCCTGAACACTGGAATAAGG - Intergenic
1083031759 11:59598931-59598953 TTTTCCGGCTAGCTGGAATAAGG + Intronic
1083033101 11:59612434-59612456 GTTTCCAAAAAGCTCCAATAAGG - Intronic
1083976590 11:66126927-66126949 TTTTCATCAAAGCAGGAAGAAGG + Intronic
1084193576 11:67510203-67510225 TTTTCCTAATGGCTGGAGTTAGG - Intergenic
1084341149 11:68502586-68502608 TTTTGCCACAACCTGGAATAAGG - Intronic
1084802941 11:71557212-71557234 TTTCACTAAAAGCTGTAACATGG + Intronic
1085653218 11:78287606-78287628 CTTTCCTAAGATCAGGAATAAGG + Intronic
1085971202 11:81592958-81592980 TTGTACCACAAGCTGGAATATGG + Intergenic
1086180454 11:83944940-83944962 TTTGCCTAAAATCTGGAATTGGG + Intronic
1086543168 11:87937040-87937062 TTCCCCTAAAAGCAAGAATAAGG - Intergenic
1086594928 11:88559339-88559361 TTGTCATAAGGGCTGGAATAAGG + Intronic
1086902496 11:92383539-92383561 TTTTCCTAATGGCTGGGATTAGG - Intronic
1088925703 11:114299195-114299217 TTATCCTAGAATATGGAATAAGG - Intronic
1088962919 11:114688153-114688175 TTTCCCTAGGAGCTGGAACAAGG - Intronic
1089722515 11:120440764-120440786 TCTCCCTAATAGCAGGAATAAGG - Intronic
1090001818 11:122967806-122967828 TTATCCTACAAGCAGGAATTTGG + Intergenic
1092085395 12:5753950-5753972 TTTTTCTAAGATCTGGAATAAGG - Intronic
1093271951 12:17074279-17074301 CTTTCTTACAGGCTGGAATAAGG + Intergenic
1093669340 12:21854323-21854345 TTCTCCTAAATGCTTTAATAAGG - Intronic
1096930736 12:55206279-55206301 TTTTTCTAAGATCTGGAAAAAGG + Intergenic
1097284686 12:57868422-57868444 TTTTCCTAATGGCTGGAATGTGG + Intergenic
1097937280 12:65267069-65267091 TTTTTCTATTTGCTGGAATAGGG - Intergenic
1098103782 12:67047725-67047747 TTTTCCACAAAGATAGAATATGG - Intergenic
1098456218 12:70677478-70677500 TTCTCCTAAGATCTGGGATAAGG - Intronic
1099583185 12:84479977-84479999 ATTTTCAAAAAGCTGGAAGAGGG + Intergenic
1099875269 12:88396816-88396838 TCTCCCTAAGAACTGGAATAAGG + Intergenic
1100491694 12:95086229-95086251 CTTTTCTAAAAGCTGGATTTGGG + Intronic
1101380555 12:104210683-104210705 TTTTCCTATAAGCTGGATGTAGG + Intergenic
1101851105 12:108403097-108403119 TTTGCCTAAGTGCTGGCATAAGG - Intergenic
1102249578 12:111377171-111377193 TTTTATAAAAAGCTGTAATATGG + Intergenic
1102440541 12:112960784-112960806 TTTCCCTGAAAGCTGAAAGATGG - Intronic
1102724886 12:115053303-115053325 TCTTCCTAAAATCAGGAATAAGG - Intergenic
1104128121 12:125866649-125866671 TTTCCATAACAGCTAGAATAGGG - Intergenic
1104137636 12:125955643-125955665 TTTTCATAAAATCTGTAAGAGGG - Intergenic
1104411427 12:128561384-128561406 TTCCCCTAAAAGCTTGAAAACGG + Intronic
1104596275 12:130122085-130122107 TTTTGTTAAAAAATGGAATATGG - Intergenic
1104687183 12:130794138-130794160 TTTTCCTAGTAGCTATAATATGG - Intronic
1105487147 13:20846213-20846235 TGTTCCTGAAAACTTGAATATGG - Intronic
1106203184 13:27561841-27561863 TTTTCATAAAAGCATGAAGATGG - Intronic
1106422742 13:29596669-29596691 TTTTCCTATAAGATAGAAGAAGG - Intergenic
1107201191 13:37719983-37720005 TGTTCTTAAAAGATGGAAGAAGG + Intronic
1107571011 13:41658107-41658129 GTTTCCTAACAGCTAGAACATGG + Intronic
1107796934 13:44062571-44062593 TTTTTATAACAGCTGGAACATGG + Intergenic
1109756276 13:66764157-66764179 ATTTCTTAAGAGGTGGAATATGG + Intronic
1110116738 13:71826881-71826903 ATTTACTATTAGCTGGAATAGGG + Intronic
1110419862 13:75294548-75294570 TACTCCTAAAATCTGGACTAGGG - Intronic
1110804798 13:79741899-79741921 TCTTCCTAAATGCTAGAACAAGG + Intergenic
1111354043 13:87075331-87075353 TTTTCCTAAAAGATAAATTAAGG + Intergenic
1112057220 13:95701049-95701071 TTGTCGAAAAGGCTGGAATAGGG - Intronic
1112228004 13:97559377-97559399 TTTTCCTGGAAGCCGGAATTGGG + Intergenic
1114629613 14:24150739-24150761 TTTTCCAAAGAGCTGGCATAGGG - Exonic
1114836480 14:26208820-26208842 ATTTCCTAAAATCTGGACTTTGG - Intergenic
1115415566 14:33128893-33128915 TTTTCATCAAAACTGGAAAATGG + Intronic
1116391905 14:44402343-44402365 TTTTCCCAAAAGCTTTACTAGGG + Intergenic
1116597953 14:46877252-46877274 TTTTCCTAAATATTGAAATATGG - Intronic
1117575906 14:57097106-57097128 CATTCCTATAAGCTGGAACATGG + Intergenic
1119930761 14:78543975-78543997 TCTGCCTGAAAGATGGAATAAGG + Intronic
1120357152 14:83449279-83449301 TATTCCTAAAATTTGGAAAAAGG - Intergenic
1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG + Intergenic
1121469092 14:94138142-94138164 TAATCCTAAAAGCTGGACTCAGG - Intergenic
1121821798 14:96974893-96974915 TTTTCATAAAATATGGACTATGG + Intergenic
1122432410 14:101662944-101662966 TTTATCTAAGATCTGGAATAAGG - Intergenic
1123451347 15:20363564-20363586 CCTTCCTAAAATCAGGAATAAGG + Intergenic
1124099152 15:26677413-26677435 CTTTCCTAAAAGCTGGTTTTGGG + Intronic
1124356838 15:29001806-29001828 TTTTTTTAAAAGATGGAAAATGG + Intronic
1125463534 15:39928644-39928666 CTTTAGTAAAAGATGGAATATGG + Intergenic
1126173845 15:45717079-45717101 TGTTGCTAAAAGCTAGAATGGGG + Intergenic
1126373617 15:47972444-47972466 TTTTCCTAAAATGAGGAAAAAGG - Intergenic
1127575217 15:60285286-60285308 TTTCACAAAAAGCTAGAATAGGG + Intergenic
1128014906 15:64335142-64335164 TTTTCCTAAAAGCATGTATTAGG - Intronic
1128164428 15:65450519-65450541 TTTTAAGAAAAACTGGAATAAGG + Intronic
1129647916 15:77454917-77454939 TTTGCATAAAGGCTGTAATATGG + Intronic
1130087215 15:80787637-80787659 TTTTCCTCAAAGCTGGACTTAGG + Intronic
1130372795 15:83300685-83300707 TATTCATAATAGCTGGAATTGGG - Intergenic
1132283568 15:100642461-100642483 TGTTACTAGAAGCTGGAAGACGG - Intronic
1132529235 16:436971-436993 TTTTCCTAATAGCTAGAAGGAGG + Intronic
1133476496 16:6126916-6126938 TTTTCCTAGTACCTGGCATAAGG - Intronic
1135392312 16:22104184-22104206 TTTTCTTAAAAGTTTGATTAAGG + Intronic
1135525939 16:23213581-23213603 ATTTCCTCAAAGCTGGGAGACGG + Intronic
1137419287 16:48317684-48317706 TTTTCCTACAGACTGGAAAATGG - Intronic
1138501212 16:57446314-57446336 TTTACCTAAAACCAGAAATATGG + Intronic
1139966250 16:70747050-70747072 TTTTCCTAATAGCTACAAAATGG + Intronic
1142808074 17:2382029-2382051 CTTTCCTAAAAGCTGGGTTCAGG - Intergenic
1143184047 17:4999992-5000014 GGTTCCTGCAAGCTGGAATATGG + Intronic
1144211456 17:13018983-13019005 TTTTTCAAAAAGCTGGTATTGGG - Intergenic
1144357020 17:14455970-14455992 TTTCACTAAAAGGTGTAATAAGG - Intergenic
1145709479 17:26957350-26957372 TTTTCCAAAACTCTGGAAAATGG + Intergenic
1146288643 17:31592520-31592542 TTTTCCTAAAAGTTGGCAGTTGG - Intergenic
1146682422 17:34817666-34817688 ATTTCCTAGATGCGGGAATAAGG + Intergenic
1148284869 17:46379679-46379701 TTCTTCTAAAAGCTGGAATGAGG - Intergenic
1148307090 17:46597601-46597623 TTCTTCTAAAAGCTGGAATGAGG - Intronic
1149255270 17:54819147-54819169 TTTTCCTAAAATCAGAAATAAGG + Intergenic
1149303202 17:55324458-55324480 TTTTCCTTAAAGGAAGAATAGGG - Exonic
1149324585 17:55516963-55516985 TTCTTCTAAAAGATGGTATAGGG - Intergenic
1151046715 17:70928970-70928992 TTTTTCTAATAGATGGAATGGGG + Intergenic
1153055256 18:939492-939514 TATTCCTAATAGATGAAATATGG - Intergenic
1153465635 18:5385291-5385313 TTTTCCTTAAACTTGTAATATGG + Intergenic
1153500935 18:5749320-5749342 TTTTCCAGAAGGCTGGATTATGG - Intergenic
1155162682 18:23208450-23208472 CTTTATTAAAAGCTGGAAGAAGG - Intronic
1156619185 18:38828541-38828563 TGTTACTAAAAGCAGCAATATGG - Intergenic
1156714073 18:39985091-39985113 TTCTCCTAAGATCTGGAATAAGG + Intergenic
1156976126 18:43223469-43223491 TTTTAAAAAAAGCAGGAATAGGG + Intergenic
1157539746 18:48492108-48492130 TTTTGGTAAAAGCTGAAATGAGG + Intergenic
1157953444 18:52066564-52066586 TTTCTCTAAAACCAGGAATAAGG + Intergenic
1158175788 18:54654456-54654478 TTTCCATAGAAGCTGGAAGATGG + Intergenic
1159909251 18:74128662-74128684 TCCTCCTAAAAGCTGGATTATGG - Intronic
1160375506 18:78408997-78409019 CTTTCCTTGAAGCTGGAATGTGG + Intergenic
1162847671 19:13406003-13406025 TTCTCCATAAAGCTGGCATATGG - Intronic
1162866822 19:13554323-13554345 CATTCCTGAAAGCTGAAATAAGG + Intronic
925015968 2:524360-524382 TTTTCCCGAAAACTGGCATATGG - Intergenic
925691179 2:6525014-6525036 TTTTCCTCAAAGGTGGGATGTGG + Intergenic
927415033 2:22870490-22870512 TTTTCATGAAAGTTGAAATAAGG - Intergenic
928047274 2:27948810-27948832 TTCCCCTAAAATCTGGAACAAGG - Intronic
929179315 2:39017437-39017459 AATTCCTAAAATCTAGAATAAGG - Intronic
929215470 2:39407288-39407310 TCTTCCTAAGAGCAGGAACAAGG + Intronic
929579374 2:43071940-43071962 TTTTCCTTAAGGCTGGAGTTTGG - Intergenic
929685603 2:44031484-44031506 TTTTCCTGGAATCTGGAAAATGG + Intergenic
929743965 2:44636176-44636198 CTATCCAAAAAGCTGGACTAAGG + Intronic
929821409 2:45276956-45276978 TTAGCCTAAAATCTGGAATAAGG - Intergenic
929953685 2:46438164-46438186 TTCTCCTAAGATCAGGAATAAGG + Intronic
930703717 2:54484505-54484527 TTCTCCTAAGAACAGGAATATGG + Intronic
931552083 2:63457834-63457856 TTACTCTAAAAACTGGAATACGG + Intronic
931910945 2:66899181-66899203 TTTTCCTCAAAGAAGGACTAGGG - Intergenic
931951714 2:67371119-67371141 TGTTCCTAAAATCAAGAATAAGG - Intergenic
933222193 2:79703329-79703351 TTTTCCCCAAACTTGGAATAAGG + Intronic
933290346 2:80431471-80431493 TTTTCCTAGAATCTGAAATTGGG - Intronic
937522772 2:122732507-122732529 TTTTCCTGAAATGTAGAATAGGG - Intergenic
938047508 2:128135640-128135662 TTTTCCAAGAAGGTAGAATAAGG - Intronic
939557770 2:143697205-143697227 CTTTCCTAAAAGTAGGAACAGGG - Intronic
939812033 2:146845468-146845490 TTTGCCTAAGAGTTGGAATAGGG - Intergenic
940315714 2:152325564-152325586 TCTTCCTAAAATCAGGCATAAGG - Intergenic
940409916 2:153349672-153349694 TTTTCCTAGGAGTTGGATTAAGG - Intergenic
940410593 2:153359612-153359634 TTTTGCTGAAAGCTGGATTTTGG - Intergenic
941450382 2:165653500-165653522 TTTCCCTAAAAGCTAGAGTTTGG - Intronic
942583148 2:177443722-177443744 TTTTCTTAAAATCTGGGATAAGG - Intronic
943656105 2:190510533-190510555 TTTTCCTAAAACATGGCATGTGG + Exonic
944276301 2:197842232-197842254 TTCTCCTCAAAACTGGAATGAGG - Intronic
945727239 2:213486397-213486419 TATTCATAATAGCTGAAATATGG + Intronic
946286252 2:218705507-218705529 TTTTCCTAAAAGATAAACTAAGG + Intergenic
947297535 2:228648683-228648705 TTTTCATAACAGCTTGGATAAGG - Intergenic
948308169 2:236965403-236965425 TTTTCCTAAGAACTTGAAGATGG - Intergenic
948687810 2:239680343-239680365 TTTTCCTAAGGGCTGGGACATGG + Intergenic
1169788784 20:9387673-9387695 TTTTCCTCAAGACTGGAAGAAGG - Intronic
1170341445 20:15332404-15332426 TTTTCCTAAAGTATGAAATAGGG + Intronic
1170640434 20:18147420-18147442 TTCTCATAAAAGCTGTAAAATGG + Intronic
1172819700 20:37720562-37720584 TTTTCATTTAAGCTGGATTAAGG + Intronic
1173943152 20:46929198-46929220 TTTTCCTGAAACCTGGAAGGAGG + Intronic
1176382878 21:6121970-6121992 TTTTCCTTAAAGCAGAAATCAGG - Exonic
1176979782 21:15368127-15368149 TTTCTCTAAAAGCTAGAAAAAGG + Intergenic
1177131951 21:17268698-17268720 ATTTCCTAAAACCTTAAATAAGG - Intergenic
1178022972 21:28430993-28431015 TTTACCTAAAGGCTGGACCAAGG - Intergenic
1178593456 21:33931663-33931685 TCTTTCTAAAAGCTGGGAAATGG + Intergenic
1179606261 21:42517449-42517471 TTTTTGTAAAAGGTGGTATAAGG + Intronic
1179740591 21:43416269-43416291 TTTTCCTTAAAGCAGAAATCAGG + Exonic
1180996004 22:19965638-19965660 TTGTTTTGAAAGCTGGAATACGG - Intronic
1182072474 22:27473533-27473555 TTTGCCTAAATGCTGGATTAAGG + Intergenic
1185020598 22:48372516-48372538 TTATGCTAAACGCTGGAATGCGG - Intergenic
949634941 3:5972644-5972666 TTTTGCTAATAGATGGAATATGG - Intergenic
949848697 3:8398938-8398960 GTTTTGGAAAAGCTGGAATAGGG - Intergenic
950001295 3:9658520-9658542 TGTTAATAAAAGCTGGAATTAGG + Intronic
950847007 3:16024291-16024313 TTTGCCTACAAGCTGGACGATGG - Intergenic
951466264 3:23003647-23003669 TGTTCCTAGAAGCTGGCGTATGG - Intergenic
951586029 3:24215504-24215526 TGTTGGTAAAACCTGGAATAGGG + Intronic
952669527 3:35949506-35949528 TCTTCCTGAAATCTGGAACAAGG - Intergenic
952832912 3:37580079-37580101 TTTTCCTAATATCTGGAATCAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955962475 3:64355124-64355146 TTTTCCCAGCAGCTGGAATGTGG - Intronic
956329777 3:68093390-68093412 TCTTCCTCAGAGCTGAAATAAGG - Intronic
956549311 3:70440437-70440459 TTCTGCTAAAATCAGGAATAAGG - Intergenic
957562713 3:81844062-81844084 GTTTCCTAACTGCTGGAAAAGGG + Intergenic
958422916 3:93948892-93948914 TTTTCATAAAATCAGGAACATGG - Intronic
958598627 3:96263894-96263916 TTTCCCTAAGATCTGGAACAAGG + Intergenic
959332702 3:105025981-105026003 TTTTCCTAAAATGGTGAATAAGG + Intergenic
959458603 3:106594883-106594905 TTTACCTAAGATCTGGAACAAGG - Intergenic
960400570 3:117192757-117192779 ATTTCCTTAAAGCTCGAAAAGGG + Intergenic
961074056 3:123965121-123965143 ATTTCCTATAAACTGGAACATGG - Intergenic
961309570 3:125987011-125987033 ATTTCCTATAAACTGGAACATGG + Intergenic
962020466 3:131495237-131495259 TTTTCCTGAGAGCTATAATATGG + Intronic
964180459 3:153877638-153877660 CTTTCCCATTAGCTGGAATATGG - Intergenic
964469887 3:157041347-157041369 TTTTCCACAAAGCTGGCAAAGGG + Intronic
964545933 3:157833591-157833613 TTTTCATAAATGCAGGAATTTGG + Intergenic
970683179 4:18535115-18535137 TTCTCCAAGAAGCAGGAATAAGG - Intergenic
970751236 4:19364469-19364491 TTTTCCTACTATTTGGAATATGG + Intergenic
970887859 4:21007360-21007382 TTTTTCTAAACCCTGGAACATGG - Intronic
971585900 4:28405341-28405363 TTTTCATAAGAGTTGAAATAAGG + Intergenic
972381730 4:38525854-38525876 TTTTCATAAAAGCAGGGATTTGG + Intergenic
972514070 4:39796191-39796213 TTTTTTTACAACCTGGAATATGG + Intergenic
973176321 4:47210532-47210554 TTGTTCTAAAATCTTGAATAGGG + Intronic
973678728 4:53293697-53293719 TTTCCCTAAAATCTGGTATATGG + Intronic
974646943 4:64706449-64706471 TTTTCCTAAAATCAGGAATAAGG + Intergenic
976068505 4:81215892-81215914 TTTTCCTGAAGGGTGCAATATGG + Intergenic
976220558 4:82753749-82753771 TTTTCCTATAAACTGGAGTCAGG - Intronic
976831655 4:89321759-89321781 TTTTCCTAATTGTTGCAATATGG + Intergenic
977856383 4:101899923-101899945 TATTCCTTAAAGCTGGACTCAGG - Intronic
978221516 4:106281486-106281508 TTTTACTAAGATCTGGAACATGG - Intronic
978356086 4:107876065-107876087 ATTTCCTAGAAGCAGGAATTGGG - Intronic
978424339 4:108566576-108566598 GTTTCCTCACAGGTGGAATAGGG + Intergenic
978695877 4:111578059-111578081 TTTTTTAAAAAGCTGGGATATGG + Intergenic
978754585 4:112288089-112288111 AATTTCTAAAAGCTTGAATAAGG + Intronic
978925810 4:114242191-114242213 TTTCCCTAAGAACTGGAACAAGG - Intergenic
981129287 4:141140626-141140648 TTCGCCAAAAAGCTGGAATGAGG + Intronic
981905000 4:149912378-149912400 TTTGCCTAACAGCTTAAATAAGG - Intergenic
982634382 4:157874424-157874446 TTTTGCTAATAGCTTGGATATGG + Intergenic
983312850 4:166087477-166087499 TTTTGGTAAAAGCTGGCATTTGG - Intronic
983441442 4:167791642-167791664 TTTTCATAAACACTGGAAAATGG + Intergenic
983731899 4:171005234-171005256 TTTTCCTAAGAACTGAAACAAGG - Intergenic
984179123 4:176459690-176459712 TTCTCCTAAAACCTGGAATAAGG + Intergenic
984448806 4:179872627-179872649 TTTTCCTAAAATCTGCCATGGGG - Intergenic
987770677 5:22299704-22299726 TTTATCTAACAGCTGGAATAAGG - Intronic
988634379 5:32966888-32966910 TTTTCACAAATGGTGGAATAAGG + Intergenic
989864475 5:46431552-46431574 TTTTCCTAAAAACTAGACGAAGG - Intergenic
990111483 5:52330941-52330963 TCTTCCTAAAGGTTCGAATAAGG + Intergenic
992003501 5:72456947-72456969 TTATCATGAAAGCTGGATTATGG - Intronic
992103938 5:73435251-73435273 TTTTCCAAAAAGAAGGATTAAGG + Intergenic
993104955 5:83589989-83590011 TGTTCCTAACACCTGCAATAGGG + Intergenic
994299369 5:98128403-98128425 TTTTGCTAAGTGCTGGCATATGG + Intergenic
994897867 5:105727958-105727980 TCTTTCTAAAATCAGGAATAAGG + Intergenic
994963526 5:106636805-106636827 TTTTACTAGAACATGGAATATGG + Intergenic
995086798 5:108120168-108120190 TGTTCCAAAACACTGGAATAGGG - Intronic
995087027 5:108123076-108123098 TTTTCCTAAAAGATCTAGTATGG - Intronic
995676567 5:114669185-114669207 TGTGGCTCAAAGCTGGAATAGGG - Intergenic
995811365 5:116110405-116110427 TGTTCCAAAAAGTTGGAACAGGG - Intronic
997631126 5:135369593-135369615 TTTTCCTGAAAGCTGCTAAAAGG - Exonic
998391520 5:141789902-141789924 TCTTCCTAAAGGCTGGGGTAGGG + Intergenic
1000229693 5:159303903-159303925 TTTTTCTAACAGCTGTAATGAGG - Intergenic
1000454037 5:161426925-161426947 ATTTCATACAAGCTGGAAGATGG + Intronic
1000529348 5:162399887-162399909 TATTTATAAAAGCTAGAATATGG + Intergenic
1000843062 5:166245711-166245733 TTTATCAAAAAGCTGGATTAAGG + Intergenic
1002420591 5:179146192-179146214 TTTCCCTAACAGCTTTAATAAGG - Intronic
1002611682 5:180423412-180423434 TTTTCCTACAACCAGGAATGTGG - Intergenic
1003455623 6:6279084-6279106 CTTTCCTAAAAGCTGGAACTGGG + Intronic
1004421840 6:15477468-15477490 TATTCCAAAAAGTTGGAATATGG + Intronic
1004851040 6:19699490-19699512 TTTTCCTCAAATCTGGTATGTGG + Intergenic
1005015182 6:21368732-21368754 TTTTTCAAGAAACTGGAATAGGG + Intergenic
1005141776 6:22640286-22640308 TTTTCCTAAAATGTGAAAAATGG - Intergenic
1005209118 6:23440602-23440624 TTTTCCTAAAATGTGGAGTTGGG - Intergenic
1005273518 6:24191642-24191664 TTTTCCTAGAATCCGCAATAGGG - Intronic
1005944698 6:30586765-30586787 TTTTGCCAGAAGCTGGAATCAGG + Intronic
1008448805 6:51625106-51625128 TTTTGGTAAAAGCTGTAATGTGG + Intronic
1009705738 6:67248965-67248987 TGTTCCAAAAAGCAGGAAGAGGG + Intergenic
1009803246 6:68569416-68569438 TTTTCCCAAAAACTGGAACAAGG - Intergenic
1010152732 6:72754092-72754114 TTTACCTAAGACCAGGAATATGG - Intronic
1010293942 6:74174095-74174117 TTTTCCTAACAGTTTGAATCTGG - Intergenic
1010621538 6:78082873-78082895 TTTCACTAAAAGCTGGAAATTGG + Intergenic
1010748630 6:79593040-79593062 TTGCCCAAAGAGCTGGAATAAGG - Intergenic
1010859200 6:80885216-80885238 TTTTCATAGGAGATGGAATAAGG + Intergenic
1010999078 6:82567296-82567318 TTTTCCTAAAGGCAAAAATATGG - Intergenic
1011812789 6:91152342-91152364 TTTTTCTAGAGGCTGGAATGGGG + Intergenic
1011953096 6:92992271-92992293 GTTTTCTAAAAGATGGAATTTGG - Intergenic
1012888193 6:104868780-104868802 TCTTTCTAAAACCAGGAATAAGG + Intergenic
1013905069 6:115206709-115206731 TTTGCCTAAATGTTGTAATAAGG + Intergenic
1015417573 6:132967197-132967219 TGTTCCTAACACCAGGAATATGG - Intergenic
1015738280 6:136424891-136424913 TTTTAATAAAATCTGGAATGTGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020540014 7:9450483-9450505 TTTGACAAAAAGCTGGAAAAAGG - Intergenic
1020765761 7:12318600-12318622 ATTTCCAAAAAGCTGCATTAAGG + Intergenic
1020856971 7:13439880-13439902 TTTTTCTAAAACCTGGGATTGGG - Intergenic
1021465742 7:20941631-20941653 TTTTCCAAAAAAATGGAAGAGGG + Intergenic
1022087501 7:27082719-27082741 TCTTCCTAAAAACTGAAATAGGG + Intergenic
1023591838 7:41788837-41788859 TTTTACTAAAAGATGGTACAGGG - Intergenic
1023715700 7:43042063-43042085 TTTTACTACAAGCTCAAATATGG + Intergenic
1023899518 7:44464825-44464847 TTAATCTAAAAGCTGGAATGGGG - Intronic
1024526223 7:50351729-50351751 TTCCCCTAAATGCTGGATTAAGG - Intronic
1024802085 7:53091606-53091628 TTTTCCGAAAAGCAGAAAGATGG - Intergenic
1025080365 7:55976547-55976569 TATTCCTATTAGCTGGCATATGG + Intronic
1028112534 7:86959393-86959415 TTTTTCTAAGATCTGGCATAAGG - Intronic
1028245471 7:88471496-88471518 TTATCCTAAATGCAGGAGTATGG + Intergenic
1028804908 7:95014063-95014085 ATTTCCTAAAATCAGGAACATGG + Intronic
1029863134 7:103597105-103597127 TTTTCCTCAAAGGTACAATATGG + Intronic
1030110281 7:106021017-106021039 TTTTCCTGAAAGCTGGTAGTGGG + Intronic
1030777654 7:113554121-113554143 TTTTTCTAAGAGCAGGAATAAGG + Intergenic
1030782258 7:113615938-113615960 TTTTCCTAGAAACTGGGAGATGG + Intergenic
1030865801 7:114700214-114700236 TTTTCCAAAAAGTGGCAATAGGG - Intergenic
1032138065 7:129299691-129299713 TACTCCTAAAAGTTGGAATCTGG - Intronic
1032426635 7:131827851-131827873 GTTTCCTAAATTCTGCAATAGGG + Intergenic
1032567799 7:132965874-132965896 TTGTCATAAAAGATGGAAGAAGG + Intronic
1033502780 7:141969593-141969615 TCTTCCTAAAAACAGGAACAAGG + Intronic
1034219524 7:149433043-149433065 TTTTCCCAAAAGAAGGAATTTGG - Intronic
1034888118 7:154814555-154814577 TTTTCTTTAAAGATGGAATTGGG - Intronic
1036385015 8:8271199-8271221 TGTTGCAAAAAGCTGGCATATGG + Intergenic
1036828647 8:12001456-12001478 TATTCCTAACAGCTGGTATTTGG + Intergenic
1037464128 8:19142574-19142596 TTTTTCCAAAAGCTGGTATGTGG + Intergenic
1039026755 8:33267112-33267134 TTTGGCTGAAAGCTGGAAGAAGG + Intergenic
1041134673 8:54744614-54744636 TTTTTCTATATGCTTGAATAGGG - Intergenic
1041349256 8:56932145-56932167 GTTTCCAAAAAGCTTCAATAGGG - Intergenic
1041809626 8:61893694-61893716 TTTCCTTAAATGCTGGCATATGG - Intergenic
1042854983 8:73257499-73257521 TTTACATAAAAGCAGGAAAATGG - Intronic
1043545792 8:81314047-81314069 TTCTTCTAAGAACTGGAATAAGG + Intergenic
1044621075 8:94191142-94191164 TTTTTTTAAAATCAGGAATATGG - Intronic
1044867442 8:96586191-96586213 TTTTTTAAAAAGCTGGAATTCGG - Intronic
1044885306 8:96770510-96770532 TTTTCCTAAAAGCCATGATAAGG - Intronic
1045680674 8:104656497-104656519 TTTTCCTAGGAGATGGAAGAGGG + Intronic
1045947029 8:107807994-107808016 CTTTCATAAAAGCTGAAACAAGG + Intergenic
1046039759 8:108888182-108888204 TTTACATGAATGCTGGAATATGG - Intergenic
1046480766 8:114814572-114814594 TTTCTCTAAAAACTGGAAGAAGG + Intergenic
1047030232 8:120869169-120869191 TTTTCCAAAAATCTGGAGTTGGG - Intergenic
1047306997 8:123660614-123660636 TTTTCATAAAAGCCTGAAAATGG - Intergenic
1048682528 8:136860264-136860286 TTTTGCTAAAATCAGGAACAAGG - Intergenic
1050022674 9:1301322-1301344 TCCTCCTACAAGCTGGACTAAGG + Intergenic
1050762879 9:9095178-9095200 TCTTCCTAAAATCAGGAACAAGG + Intronic
1051965379 9:22822401-22822423 TTTTCCTAACACCTCAAATAAGG - Intergenic
1052686199 9:31760000-31760022 TTCCTCTAAAAACTGGAATAAGG - Intergenic
1053005740 9:34603228-34603250 TGTCTCTAAAAGTTGGAATACGG + Intergenic
1056310930 9:85340120-85340142 TTTCCCCAAGAGCTGGAATTAGG - Intergenic
1058213600 9:102203995-102204017 TTTTCCTAAGAGAGGGAATTGGG - Intergenic
1059153181 9:111967271-111967293 TTTGCCAAAATGATGGAATAGGG + Intergenic
1059910922 9:119043250-119043272 TTTTGCTAGAAGCTGAAATAGGG + Intergenic
1187958063 X:24540168-24540190 TTTTGCTAAAAGTTGGAAGTGGG + Intergenic
1187973453 X:24681884-24681906 ATATCTTAAAAGCTGGAAAAAGG - Intergenic
1188099238 X:26062395-26062417 TTCCTCTAAAAGCTGGAAAAGGG + Intergenic
1190169908 X:48103969-48103991 TTTTACTAAAAGCAGTAAGATGG - Intergenic
1190838715 X:54126275-54126297 TTCTCCTAAAATCAGGAAGAAGG - Intronic
1191983818 X:66956750-66956772 TTCTTCTAACAACTGGAATAAGG - Intergenic
1193242609 X:79189395-79189417 TTGTTCTAAAATCAGGAATAAGG - Intergenic
1193286040 X:79715996-79716018 TTTTCCTACAAGCTTCAGTAAGG - Intergenic
1193437026 X:81487267-81487289 TCTTCCTATGATCTGGAATAAGG + Intergenic
1193764900 X:85515587-85515609 TGTTCCCAAAACCTGGCATAGGG + Intergenic
1194210641 X:91065314-91065336 TCTTCCTAAAATCAGGAACAAGG + Intergenic
1195703165 X:107720133-107720155 TTTTCCTAAAAGCTGGAATAGGG - Intronic
1195848540 X:109255977-109255999 TTTTTCTAATAGGAGGAATAAGG + Intergenic
1196728279 X:118916893-118916915 TTTCCCTGAAAACTGGTATATGG + Intergenic
1197239826 X:124111477-124111499 TTTTCCTCAATGGTAGAATAAGG - Intronic
1197296990 X:124730860-124730882 TTTTCCTAAAGTCTGGGATTTGG - Intronic
1198658268 X:138938367-138938389 TTCCCCCAAAAGCTGGAAGAAGG - Intronic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1199195496 X:145024791-145024813 CTTTCCTACAAGATGGCATAAGG - Intergenic
1199214603 X:145250510-145250532 TGTTTTTAAAAGCTGGAGTAGGG + Intronic
1200524277 Y:4252464-4252486 TTTTACTAACATCTGGAACATGG + Intergenic
1201925471 Y:19282405-19282427 TTTTTCTAAGATCAGGAATATGG - Intergenic