ID: 1195704126

View in Genome Browser
Species Human (GRCh38)
Location X:107726192-107726214
Sequence CTCTCCAAGGGGGAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195704109_1195704126 20 Left 1195704109 X:107726149-107726171 CCCTCCCTGGCAACAAGGCCATC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704108_1195704126 21 Left 1195704108 X:107726148-107726170 CCCCTCCCTGGCAACAAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 228
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704113_1195704126 2 Left 1195704113 X:107726167-107726189 CCATCTCCCCTGCTCGCTGACTC 0: 1
1: 0
2: 1
3: 42
4: 450
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704110_1195704126 19 Left 1195704110 X:107726150-107726172 CCTCCCTGGCAACAAGGCCATCT 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704116_1195704126 -6 Left 1195704116 X:107726175-107726197 CCTGCTCGCTGACTCCCCTCTCC 0: 1
1: 0
2: 3
3: 38
4: 404
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704111_1195704126 16 Left 1195704111 X:107726153-107726175 CCCTGGCAACAAGGCCATCTCCC 0: 1
1: 0
2: 1
3: 19
4: 267
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704115_1195704126 -5 Left 1195704115 X:107726174-107726196 CCCTGCTCGCTGACTCCCCTCTC 0: 1
1: 0
2: 1
3: 21
4: 350
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704114_1195704126 -4 Left 1195704114 X:107726173-107726195 CCCCTGCTCGCTGACTCCCCTCT 0: 1
1: 0
2: 1
3: 32
4: 358
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1195704112_1195704126 15 Left 1195704112 X:107726154-107726176 CCTGGCAACAAGGCCATCTCCCC 0: 1
1: 0
2: 1
3: 21
4: 230
Right 1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195704126 Original CRISPR CTCTCCAAGGGGGAGTAGGA GGG Intronic
900250146 1:1664661-1664683 CTCCCCAAGGGACAGTAGTACGG - Exonic
900261178 1:1730567-1730589 CTCCCCAAGGGACAGTAGTACGG - Intronic
901715588 1:11151118-11151140 CGCTCTAAGGTGGTGTAGGAGGG + Intronic
902413796 1:16227184-16227206 CTCTCCCAGGAGGAGAGGGAAGG + Intergenic
902480465 1:16708761-16708783 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
903289050 1:22296341-22296363 CTCTCCTAGAGAGAGAAGGAGGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905441738 1:38000391-38000413 CTCTCCCAGAGGCAGTAGGAGGG - Intronic
905919769 1:41711684-41711706 AGCTCCAAGGGGTAGCAGGAAGG - Intronic
906167261 1:43695964-43695986 CTCTGCAAGGGAGAGAAGGAGGG + Intronic
906506008 1:46380156-46380178 CTGTCCAAGGGAGAGAAGAAGGG - Intergenic
906661297 1:47584338-47584360 CCCTTCAAGGAGGAGTAGGCAGG + Intergenic
906663286 1:47597803-47597825 CTCTAAAAGGGGGATCAGGATGG - Intergenic
907305332 1:53509881-53509903 CTCTGGAAGGGTGGGTAGGACGG + Exonic
908477240 1:64501712-64501734 CTCTGCAAGGTGTAGAAGGATGG + Intronic
909329630 1:74396047-74396069 CTCTTTAAGGGGGAGCATGAGGG - Intronic
909667713 1:78154134-78154156 CCCTCCAAGGTGCAGGAGGAGGG - Intergenic
911132069 1:94399153-94399175 CACTCCAAGGGGCTGTAGAAGGG - Intergenic
912223498 1:107704294-107704316 GTCTTCAAGAGGGAGTTGGATGG - Intronic
914675512 1:149904724-149904746 CTCTAACAGGGGGAGAAGGATGG + Exonic
917361892 1:174185717-174185739 CTTTCAAAGGGGGTGCAGGAAGG - Intronic
918096566 1:181341119-181341141 CTCTCGGAGGTGGACTAGGAGGG - Intergenic
918534654 1:185560815-185560837 CTCAGCAAGGTGGAGAAGGATGG - Intergenic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920508887 1:206536262-206536284 GTCTCCAAGTGAGAGGAGGAGGG + Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1073566132 10:104537113-104537135 GTCTCCAAGGGGGAGTGAGGGGG - Intergenic
1074813956 10:117131039-117131061 CCCTCCAGGGGTGAGAAGGAAGG - Intronic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1079887016 11:26002131-26002153 CTCTCCAAGGGGGAGAAACCTGG + Intergenic
1082873419 11:57964566-57964588 CTCTCCAAGGTGGAGATGGAAGG + Intergenic
1084122374 11:67077286-67077308 CTCTGCCAGGGTGAGGAGGATGG - Intergenic
1084215663 11:67645645-67645667 CTCCCCAGAGGGGAGTGGGAGGG - Intronic
1084274698 11:68045289-68045311 CTCAACAAGGGGGAGTTGGCTGG - Intronic
1086867795 11:92001255-92001277 CACTCCAAAAGGAAGTAGGAAGG - Intergenic
1087651971 11:100878400-100878422 TTCTCCATGCGGTAGTAGGAGGG + Intronic
1089774824 11:120828829-120828851 CTCTCCAAGGGGTAGCAGGCTGG + Intronic
1090384997 11:126352664-126352686 CTCAGCAAGAGGCAGTAGGATGG - Intergenic
1090777127 11:129975544-129975566 CCCACCATGGGGGAGTGGGATGG - Intronic
1094356943 12:29588115-29588137 CTCCTCAGTGGGGAGTAGGATGG - Intronic
1096917240 12:55046579-55046601 CTCTCCAAGTGGAAGGAGGGTGG - Intergenic
1098853207 12:75622716-75622738 CCCTCCAAAGTGGAGTAGGCGGG - Intergenic
1100504841 12:95209278-95209300 CTCTCCAGTGGGGAGCAGAAGGG - Exonic
1101092280 12:101299950-101299972 CTGTCCAAGGGGGAGAAAAAGGG - Intronic
1101626417 12:106447248-106447270 CTCTTGTAGGGGGAGTGGGAGGG - Intronic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1104034546 12:125089313-125089335 CACTGCAGGGGGGAGAAGGAGGG + Intronic
1107817849 13:44260152-44260174 CTCTCCAGGGGTGACTTGGACGG + Intergenic
1109074791 13:57821274-57821296 CTCTCAAAAGGTGAGGAGGATGG + Intergenic
1113505982 13:110816233-110816255 CTTTCCAAGGGGTTGTTGGAAGG - Intergenic
1113932721 13:113976761-113976783 CCCTCCAAGAGGAAGTAGAAGGG - Intergenic
1116162602 14:41288763-41288785 CACTGCAAGTGGGAGTAGCAAGG - Intergenic
1117897433 14:60502253-60502275 CTCAGCAATGGGGAATAGGAAGG + Intronic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119584228 14:75817305-75817327 TTCTACAAGGGGGAGAAGAAGGG - Intronic
1121050978 14:90818725-90818747 CCCACCAAGAGGGAGCAGGAAGG + Intergenic
1121389658 14:93563171-93563193 GTTTCAAAGGGGGAGTAGGTGGG + Intronic
1121549466 14:94787814-94787836 CTCTTCAAAGAGGTGTAGGAAGG - Intergenic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1126692608 15:51299371-51299393 CTGGCCAAGGGGGATTAGAATGG - Intronic
1127260490 15:57323420-57323442 CTCCCCAAGGGCTACTAGGATGG - Intergenic
1128472712 15:67968434-67968456 GCCCCCAAGAGGGAGTAGGATGG + Intergenic
1128915857 15:71561781-71561803 CCCTCCCAGGTGGAGAAGGAAGG + Intronic
1129750429 15:78059058-78059080 ATCTTGAAGGGTGAGTAGGAAGG - Intronic
1130549520 15:84881099-84881121 TCCTCCATGGGGGAGTATGACGG - Intergenic
1130985468 15:88842037-88842059 CTCTCCAAAGTGGAGTGCGAGGG - Intronic
1131558282 15:93418021-93418043 CCCTCCCAGGGGCAGAAGGAAGG + Intergenic
1132190526 15:99852297-99852319 CTCTCCGAGGGTGGGGAGGATGG - Intergenic
1133342130 16:5043648-5043670 CTTTCCCAGTGGGAGAAGGAAGG - Intronic
1134051575 16:11141332-11141354 CTCTGCACGGGGGCCTAGGACGG - Intronic
1136911267 16:34146451-34146473 CACTCCAAAAGGGAGGAGGAGGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1138303653 16:55955115-55955137 CTCTCCCTGGGGCAGAAGGAAGG - Intronic
1140822679 16:78678097-78678119 CTCTCCAGTGGGGAGGGGGAGGG - Intronic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1143682630 17:8488685-8488707 CTCTCCAAAGGGGAGAAACAAGG + Intronic
1143789884 17:9286257-9286279 TTCTCCAAAAGAGAGTAGGAAGG + Intronic
1144627281 17:16850612-16850634 CTCTCCGAGGGAGAGAAGGCAGG - Intergenic
1144879157 17:18422100-18422122 CTCTCCCAGGGAGAGAAGGCAGG + Intergenic
1145153077 17:20522287-20522309 CTCTCCGAGGGAGAGAAGGCAGG - Intergenic
1147228073 17:38996374-38996396 CTCAGCAAGAGGGAGTGGGAAGG - Intergenic
1147980911 17:44273261-44273283 TTCTCCAAATGGGAGGAGGAGGG + Intergenic
1148135830 17:45291029-45291051 CTCTCCTAGAGGGAGTGGGCTGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151718701 17:75844079-75844101 CTCCCCAGGGTGGAGTAGGCAGG + Intronic
1153302010 18:3599473-3599495 CTCTGAAGGTGGGAGTAGGATGG - Intronic
1153312075 18:3686717-3686739 CCCTCCAAGAGTGAGTAGGAAGG + Intronic
1153810951 18:8751003-8751025 TGCTCCAAGGAGGAGGAGGATGG + Intronic
1157394124 18:47327586-47327608 CCCTCCCAGGGGGACCAGGAAGG - Intergenic
1158648403 18:59267091-59267113 GTCTCCTTGGGGGAGGAGGATGG - Exonic
1158688229 18:59634242-59634264 CTCTGCAAGGGGAAGCAGCAGGG + Intronic
1164388337 19:27795218-27795240 CTCTCCAAGGGGGGATGGGCTGG - Intergenic
1164757930 19:30704141-30704163 CTCTCCAATGGGGAGCTGGCAGG + Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166563292 19:43747707-43747729 CCACCCAAGGGGGAGAAGGAGGG - Exonic
1166810101 19:45509282-45509304 CTCTCCAGGGCGGACTTGGAAGG - Intronic
1168679277 19:58301763-58301785 TTCTCAAAGGGGGTGTGGGAAGG + Exonic
1202714507 1_KI270714v1_random:34669-34691 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
925330155 2:3052360-3052382 TTCTCCAAGTGGCAGTAAGATGG - Intergenic
929075334 2:38075546-38075568 TTCTCCAAGGGAGAGTGGGTTGG - Intronic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
931063881 2:58562463-58562485 CTCTTAATTGGGGAGTAGGAAGG + Intergenic
931068309 2:58613165-58613187 CTCTCCACAGAGGAGTGGGAAGG - Intergenic
931075898 2:58711124-58711146 TTACCCAAGGGAGAGTAGGAGGG + Intergenic
931207869 2:60165305-60165327 CCCTCAATGGGGAAGTAGGAGGG - Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
935426791 2:102927934-102927956 CACTCCAAAAGGGAGGAGGAAGG + Intergenic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
935755875 2:106275922-106275944 CACCCCAAGGTGGAGTAGGCGGG + Intergenic
937624268 2:124025531-124025553 CTCTCCAAGCGGGGGTGGGAGGG + Exonic
943520763 2:188945856-188945878 CTCTCAAAAGTGGAGTAGAATGG + Intergenic
944883316 2:204037850-204037872 CTCTTCAATGGGGAATAAGAAGG + Intergenic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
946846166 2:223860718-223860740 CTCTCCAAGGGTGGCCAGGATGG - Intronic
947593298 2:231396633-231396655 ACCTCCAAGGGGGAGGAGCAGGG - Intronic
948071970 2:235135166-235135188 CTGTCCAAGGGTGAATTGGAAGG - Intergenic
948229739 2:236341357-236341379 CTCTCCTAGGAGGAGGAGAAAGG + Intronic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
1168806602 20:675513-675535 GTCTCCAAGGGGTGGTAGGTGGG + Exonic
1169081810 20:2801787-2801809 CAATCCAAGGGCGAGTTGGATGG - Intergenic
1169211423 20:3768000-3768022 CACTCGAAGAGGGAGAAGGAGGG + Intronic
1171769914 20:29314411-29314433 CACTCCAAAGGGGAGGAGGAGGG + Intergenic
1171812641 20:29757604-29757626 CACTCCAAAAGGGAGGAGGAGGG + Intergenic
1171906602 20:30904698-30904720 CACTCCAAAAGGGAGGAGGAGGG - Intergenic
1172044969 20:32073827-32073849 CTGTCTTAGGGGGAGTGGGATGG - Intronic
1173761913 20:45569208-45569230 CTCTCCTAAAGGGAGAAGGATGG - Intronic
1175185691 20:57178440-57178462 CCCTCCGTGGGGGAGTAGCAGGG + Intronic
1175391571 20:58631002-58631024 CTCTCCAAAGGGGAGTGGGCTGG + Intergenic
1175688734 20:61050421-61050443 TTTTCCAAGGGGGAGTTGCAAGG - Intergenic
1175931534 20:62496065-62496087 CCCTACAAGGGGGAGTGGGCGGG - Intergenic
1178284172 21:31311236-31311258 CCCTCCAAAGGGGAGCAGGAGGG + Intronic
1178978252 21:37239132-37239154 GCCTCCAAGGAGGAGCAGGAGGG + Intronic
1180315332 22:11272699-11272721 CACTCCAAAAGGGAGGAGGAGGG + Intergenic
1180340018 22:11610792-11610814 CACTCCAAAAGGGAGGAGGAGGG - Intergenic
1181197937 22:21201651-21201673 TTCACCAAGGGAGAGTTGGAGGG + Intergenic
1181829487 22:25548350-25548372 CTCTAAAAGAGGGAGAAGGAGGG + Intergenic
1182905823 22:33935439-33935461 CCCTCCCAGTGGGAATAGGATGG + Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
952195991 3:31075834-31075856 CCCTGCAATGGGCAGTAGGAGGG + Intergenic
952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG + Intronic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
954455962 3:50600021-50600043 AGCACCAAGGGAGAGTAGGAGGG - Intergenic
957564646 3:81868085-81868107 ATCTCTAAGGGAGAATAGGAGGG - Intergenic
957866829 3:86036418-86036440 TTTAGCAAGGGGGAGTAGGAAGG - Intronic
959948775 3:112154676-112154698 CATTCCAAGGGGGAGTGGAAAGG + Intronic
961511267 3:127405228-127405250 CTCACCTTGGGTGAGTAGGAAGG + Intergenic
966318781 3:178677773-178677795 CCCTTCAAGGGGGAGAAGGATGG + Intronic
969524889 4:7699394-7699416 CTCTCCAAGCGTGGGCAGGAGGG - Intronic
971201004 4:24509136-24509158 CTTTACAAGAGGGAGCAGGAGGG - Intergenic
972431095 4:38983006-38983028 AGCTCCAAGGAGGAGTATGAGGG - Intronic
973703917 4:53563442-53563464 CCCTCCTAAGGGGAGTAAGAGGG + Intronic
974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG + Intergenic
975990356 4:80253428-80253450 ATCTCCAAGGGGGAGAAAGAGGG + Intergenic
978957696 4:114634425-114634447 CTCTCCAAGGAAGAGGAGGAGGG + Intronic
979654729 4:123179207-123179229 ATCTAGAAGGAGGAGTAGGATGG + Intronic
980159270 4:129139460-129139482 CTCTCCCAGGGGGCTTAGTATGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983734995 4:171046158-171046180 CTCTCTAAGGAGGAGTAAGAAGG - Intergenic
985906661 5:2843050-2843072 ATCTCCATGGGGGAGCATGATGG - Intergenic
986177828 5:5366904-5366926 CTTTGCAAGGGGGAGTAGCCTGG - Intergenic
991009775 5:61870781-61870803 CTCCCCTAGGAGGAGTAGGGTGG - Intergenic
991092696 5:62708367-62708389 CTCTCCAAGGAGGTCTAGGCTGG + Intergenic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1000639771 5:163687845-163687867 CTCTTCAAGGGGCAGTGAGAAGG + Intergenic
1003563640 6:7204153-7204175 CTCTCCCAGGGTGTGGAGGAAGG - Intronic
1005590000 6:27312933-27312955 TTCTCCAAGTGCGAATAGGAAGG - Intergenic
1006014733 6:31071110-31071132 CCCTCCAAGGTTGAGTAGAATGG - Intergenic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006676904 6:35771190-35771212 CTCACCGAGTGGGAGAAGGAAGG + Intergenic
1006729456 6:36225347-36225369 CTCACCAAGGCAGGGTAGGAGGG - Exonic
1007509841 6:42366477-42366499 CACTCTAACGGGGAGGAGGATGG + Intronic
1009055242 6:58327170-58327192 CTCTCCAAAGTGGGGTAGGCAGG - Intergenic
1011189910 6:84717791-84717813 CTCTTCAAGGGGGAGAAAGCTGG - Intronic
1014019568 6:116571684-116571706 CGCCCCGAGGTGGAGTAGGACGG + Intronic
1016387435 6:143542218-143542240 CTCTCCCTGGGGGAGAAGGAAGG - Intronic
1016402778 6:143698880-143698902 CAATCCAAGGGAGAGGAGGAAGG - Intronic
1017786440 6:157760806-157760828 TTCTCCATGAGGGAGTAGGAAGG - Intronic
1017962226 6:159232730-159232752 CTTTCCAAGGGCGGGAAGGATGG + Exonic
1019194957 6:170275751-170275773 TTCTTCAAGAGGGAGTAGAAAGG + Intergenic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1021412420 7:20343379-20343401 CACCTCAAGGGGGAGTGGGAGGG - Intronic
1021838895 7:24706468-24706490 CTTTCCTCGGGGGAGTGGGAAGG - Intronic
1022253887 7:28636266-28636288 CTCTCCACTGGGGGGTGGGAGGG + Intronic
1024244608 7:47459796-47459818 GTCTCCAGTGGGGAGGAGGACGG - Intronic
1028880757 7:95877111-95877133 CTCTCCAAGTGGGAGCTGGCAGG - Intronic
1032034044 7:128508569-128508591 CCCTCCAAGGGTGAGCAGAATGG + Intergenic
1034353419 7:150432201-150432223 TTCTCCAGGTGGGAGAAGGAGGG - Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1038489096 8:27956918-27956940 CTCTCCAAAAGGGTGGAGGACGG + Intronic
1039390239 8:37174527-37174549 CTCTCCAGGGAGGACTTGGAGGG - Intergenic
1039465876 8:37784637-37784659 CTCACCAACGTGGAGCAGGACGG - Intronic
1040822138 8:51573389-51573411 CTTTCCAGTGGGGAGCAGGAAGG - Intronic
1042425703 8:68645247-68645269 ATTTCCAAGGGCGAGTGGGAAGG + Intronic
1047520173 8:125589992-125590014 CACTTCAAGTGGGAGTAAGAAGG - Intergenic
1047521775 8:125600492-125600514 CTCTCCAAGGCAGAGCAGAAAGG - Intergenic
1050106737 9:2173694-2173716 ATCTCCAAGAAGGAGTAGGAAGG - Intronic
1050957821 9:11687253-11687275 CTGCCCAAGGAGGAGTAGCAGGG + Intergenic
1051498306 9:17749446-17749468 CTCTCCAGGGGTGAGGGGGAAGG - Intronic
1052501633 9:29299121-29299143 ATCTCAAAGGAGCAGTAGGAAGG - Intergenic
1055153988 9:73038623-73038645 TTCTGTAAGAGGGAGTAGGATGG - Intronic
1055789638 9:79910130-79910152 CTGCCCAAGGGAGAGGAGGAGGG + Intergenic
1057303290 9:93898748-93898770 CTCTTCTAGGGGAAGAAGGAGGG + Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1060281660 9:122219458-122219480 CTCTTCGAGGGGGAGTAGGCTGG - Intronic
1060586524 9:124790055-124790077 CTCTCCAAAGGGTTGTAGCAAGG - Intronic
1062158133 9:135065468-135065490 TTCCCCAAGGGGAAGCAGGATGG - Intergenic
1203363621 Un_KI270442v1:238610-238632 CACTCCAAAAGGGAGGAGGAGGG + Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1186110077 X:6246399-6246421 CTGTCCAAGGGGGAAAAGGGTGG - Intergenic
1190440143 X:50469085-50469107 CTCGCCCAAGGGGAGTAGGGAGG - Intronic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196758164 X:119176252-119176274 CTATCCAGGGGGCAGTAGGTAGG + Intergenic
1201074694 Y:10178229-10178251 CACTCCAAAAGGGAGGAGGAGGG - Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic