ID: 1195704615

View in Genome Browser
Species Human (GRCh38)
Location X:107729811-107729833
Sequence GACATGGATGTGTTTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195704615_1195704624 18 Left 1195704615 X:107729811-107729833 CCCTGTGTAAACACATCCATGTC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1195704624 X:107729852-107729874 AACAGCTTAAAATAAGTGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 201
1195704615_1195704622 14 Left 1195704615 X:107729811-107729833 CCCTGTGTAAACACATCCATGTC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1195704622 X:107729848-107729870 GTAGAACAGCTTAAAATAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 160
1195704615_1195704623 15 Left 1195704615 X:107729811-107729833 CCCTGTGTAAACACATCCATGTC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1195704623 X:107729849-107729871 TAGAACAGCTTAAAATAAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195704615 Original CRISPR GACATGGATGTGTTTACACA GGG (reversed) Intronic
901305118 1:8227213-8227235 GACAAGAATGTGTTTGCCCAAGG + Intergenic
902884678 1:19396162-19396184 GACATGCATGTGTCTCCCCAGGG + Intronic
905097993 1:35491584-35491606 AACTTGGATTTGTTTAAACAGGG + Intronic
908489039 1:64624559-64624581 GACATGAGTGTGTGTAAACATGG - Intronic
909126325 1:71675306-71675328 GCCATGGATGTTTTTATGCAAGG - Intronic
909930803 1:81497441-81497463 TTCAAGGATGTCTTTACACAGGG + Intronic
910174927 1:84419058-84419080 GGCAGGGATGTTTTTACACTAGG - Intergenic
915291176 1:154884463-154884485 GACAAGGATCTCTTTTCACAGGG - Intergenic
918300282 1:183197821-183197843 GTCATGGATGAGATTACCCAAGG + Intronic
918577414 1:186079593-186079615 TACATGGATGTGTTTGGTCAAGG - Intronic
919029705 1:192225830-192225852 GAAATGAATATTTTTACACACGG + Intergenic
920913614 1:210240005-210240027 CACATGGGGGTGGTTACACAGGG + Intronic
921880226 1:220247115-220247137 GGCATGGATGTGTTGAAAAAGGG + Intronic
921892454 1:220366855-220366877 GACAAGGGTGTAGTTACACAAGG - Intergenic
923413945 1:233736406-233736428 CACATGTATGTATATACACATGG - Intergenic
1063435232 10:6024127-6024149 CACATGCATGTGTTTATAGAAGG + Intronic
1067166943 10:43872975-43872997 GACAAGGACTTGTTTAGACAGGG + Intergenic
1067260706 10:44688267-44688289 GACAAGGATGTTTTCACAAAAGG - Intergenic
1068087555 10:52393257-52393279 GAAAAGAATGTGTTTACAGAAGG - Intergenic
1068476660 10:57535636-57535658 CACATACATATGTTTACACAAGG - Intergenic
1071302992 10:84271020-84271042 GGCTTGGATATGTTGACACATGG - Intergenic
1072573782 10:96681174-96681196 GACACAGATGTGTGCACACACGG - Intronic
1073046941 10:100644984-100645006 TCCATGTATGTGTGTACACATGG - Intergenic
1073161204 10:101397473-101397495 GACAGAGATCTGTCTACACATGG - Intronic
1076099592 10:127765023-127765045 AACATGCATGTGTGTAAACATGG - Intergenic
1076740361 10:132479798-132479820 CACATGGAAATGTGTACACAGGG + Intergenic
1078649495 11:13175091-13175113 GCCATTGATGTGCTTACCCAAGG - Intergenic
1080040441 11:27754255-27754277 GCCACGGCTGTGTTTATACAGGG - Intergenic
1084267303 11:68011699-68011721 GACAGGGATGTGGTGACAGAGGG - Intronic
1085817694 11:79758000-79758022 CACATGCATGTGTGCACACATGG + Intergenic
1085840350 11:80004607-80004629 GGCATGGAAGTGTTTACAAATGG + Intergenic
1086207047 11:84271422-84271444 GGCAGGGATGTGTTAATACATGG - Intronic
1090567982 11:128016375-128016397 GACATGGATGGATTTAGACTTGG + Intergenic
1091692920 12:2609339-2609361 GACAGGGATGTGTTTCCCCACGG - Intronic
1091945019 12:4531854-4531876 GCCTTGGATGGGTTTCCACATGG - Intronic
1095817807 12:46443665-46443687 GGCATGGATGTGTTAGCTCAGGG + Intergenic
1100773985 12:97954539-97954561 AACATGGATGTATTCTCACAAGG - Intergenic
1100937434 12:99685440-99685462 GGCATGGATGTGGTGACAAAGGG + Intronic
1101546180 12:105715235-105715257 CAAATGGATGTGTTTGCAGAGGG - Intergenic
1102436018 12:112924249-112924271 GACAAGGTTGTGTTAACTCAAGG - Intronic
1104645873 12:130496892-130496914 GACTGGGATGTGTATACACTGGG + Intronic
1105875039 13:24544275-24544297 GACATGGATGTATGTTGACATGG + Intergenic
1106033090 13:26020035-26020057 GACAAAGATGTGTTAACACTGGG - Exonic
1108500183 13:51063239-51063261 GGCATGGAGGTGTTTAGACCTGG + Intergenic
1109452063 13:62529408-62529430 GACATTAATTTGTTTACTCAAGG - Intergenic
1109644723 13:65238167-65238189 TACATTTATGTATTTACACATGG + Intergenic
1109712568 13:66179986-66180008 GGCAGGGATGAGGTTACACATGG - Intergenic
1110598660 13:77346758-77346780 GACATGGATATGTTACCATATGG + Intergenic
1111067724 13:83119078-83119100 CACATGTATATGTATACACATGG + Intergenic
1111090577 13:83440553-83440575 CACATGGATGGATGTACACATGG + Intergenic
1111964599 13:94848015-94848037 TATATGTATGTGTGTACACACGG + Intergenic
1112952478 13:105017345-105017367 GACTTTGGTGTGTTTAAACAGGG - Intergenic
1113103263 13:106744354-106744376 GTCATGGAGTTGCTTACACATGG - Intergenic
1114504285 14:23197091-23197113 GACATGTATGTGGTAACACTTGG + Intronic
1115444854 14:33478180-33478202 GAGATGGATGTGTATATTCATGG + Intronic
1118138384 14:63052483-63052505 GACTTAGAAGTGTTTACACAGGG - Intronic
1122327863 14:100893282-100893304 GACATGGTGGTGTGTACTCAAGG - Intergenic
1122710906 14:103657160-103657182 GACATGCATGTGTGTACACGAGG + Intronic
1123108397 14:105853750-105853772 CACATGGATATGTGCACACATGG - Intergenic
1123783709 15:23648050-23648072 CACATGGATGACTTTTCACAGGG + Intergenic
1127380679 15:58428337-58428359 GAAATGGCTGTGTTGGCACATGG - Intronic
1129895624 15:79103670-79103692 GAGAAGGAGGTGTATACACATGG + Intergenic
1130416438 15:83698716-83698738 GAAATGGCTGAGTTCACACACGG - Intronic
1133460210 16:5980872-5980894 CACATGGTTTTGTTTACACTGGG + Intergenic
1138133689 16:54503195-54503217 GGCATGGAGGTGGTGACACATGG + Intergenic
1138631160 16:58295258-58295280 GACAAGCATGTGTGGACACAGGG - Intronic
1139766335 16:69233525-69233547 GACATGGATGTGCTTATATATGG + Intronic
1142582388 17:950117-950139 CCCATGGATGTGTATTCACAGGG - Intronic
1143911430 17:10253137-10253159 AACATGGAAGGGGTTACACAGGG + Intergenic
1144047164 17:11464517-11464539 GACGTGGGTGTGTATAGACAGGG - Intronic
1144149655 17:12430984-12431006 GACATGGATGTGAGTGCCCAGGG - Intergenic
1146551001 17:33780440-33780462 GACAGGGATGGGTTTGCACTGGG - Intronic
1148192020 17:45685924-45685946 GAGATGGCTATGTATACACAAGG + Intergenic
1149022942 17:51991300-51991322 GACATGGATGTGTTTGCAGCTGG - Intronic
1149105610 17:52960910-52960932 GAAATGGATGTGATTATAAAAGG - Intergenic
1150022333 17:61630111-61630133 CACATGGATGTGTTCACAACTGG - Intergenic
1150413642 17:64968818-64968840 TACATTCATGTGTTTACTCATGG - Intergenic
1150631336 17:66882479-66882501 GACATGGATGAGATTACTCATGG + Intronic
1152032381 17:77852510-77852532 CACATGCATGTGTGTGCACACGG + Intergenic
1152492332 17:80645242-80645264 GACATGGCCGTGTTGGCACATGG + Intronic
1153528758 18:6022218-6022240 GAAAAGGAAGTGGTTACACATGG - Intronic
1155104787 18:22652410-22652432 CATATGGTTGTGTTTAAACATGG + Intergenic
1156476650 18:37409777-37409799 GACAGGGCTCTGTTTACAGATGG + Intronic
1156809153 18:41225464-41225486 GGAATGGTTGTGTTTACCCAAGG + Intergenic
1156929158 18:42620126-42620148 GACTTGGGTTTGTTTTCACATGG + Intergenic
1157442941 18:47724258-47724280 TACATGGCTGTGTTCACACAGGG - Intergenic
1160893023 19:1389347-1389369 CACATGCATGTGTCCACACAAGG - Intronic
1161610165 19:5237956-5237978 GCCCTGGGTGTGTGTACACAGGG - Intronic
1162323116 19:9981893-9981915 CACATGTAGGTGATTACACATGG - Intronic
1166698674 19:44869048-44869070 GAAAGGGAAGTGTTTACTCAAGG - Intronic
1166904733 19:46100110-46100132 GAGATGGATGAGTTGACAGAAGG - Intergenic
925184469 2:1837550-1837572 GACATGGAGTTGTGTGCACAAGG + Intronic
925567250 2:5269615-5269637 CACATGGATGTGTGGACTCATGG - Intergenic
925968293 2:9086808-9086830 AACGTGGAAGTGTTTATACACGG - Intergenic
929203716 2:39266177-39266199 GACAAGGTTGGGTTTAGACATGG - Intronic
929938970 2:46315859-46315881 GAGATAGATGTGTGTGCACATGG - Intronic
932875965 2:75452385-75452407 AACATAGATGTGTGTACATATGG - Intergenic
935335924 2:102016696-102016718 CACATGACTGTATTTACACAGGG + Intronic
936785319 2:116087648-116087670 GAAAAGGATGTGTATACACTGGG + Intergenic
937752635 2:125495737-125495759 AACATATATGTGTTCACACAAGG - Intergenic
939803232 2:146739036-146739058 GAAATGGAAGTATTTATACATGG - Intergenic
943177630 2:184497522-184497544 CACATGCATGTGTTTATATATGG - Intergenic
943187111 2:184624425-184624447 GACATGCATGTGCATAAACATGG - Intronic
944911875 2:204318307-204318329 GCCATGTGTGTGTTCACACAGGG - Intergenic
945766751 2:213990151-213990173 GAAATGTATGTGGTTACAAATGG + Intronic
946695109 2:222348951-222348973 GACATGGATGAGTTTATTTACGG - Intergenic
1173381618 20:42549672-42549694 GAGGGGCATGTGTTTACACATGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1177072911 21:16533391-16533413 GCAGTGTATGTGTTTACACATGG + Intergenic
1177517722 21:22176863-22176885 GGCCTGGATGTGATGACACATGG + Intergenic
1181158207 22:20938766-20938788 GTCATGGGTGTGTGTACCCAGGG - Intronic
1185129536 22:49031167-49031189 TACATGTATGTGTGTGCACATGG + Intergenic
1185308155 22:50134677-50134699 GACGTGGCTGTCTTTACATAGGG + Intronic
949563558 3:5224853-5224875 TGCATGGATGTGTTTAGCCAGGG + Intergenic
950548291 3:13652050-13652072 GTCATGGTGGGGTTTACACAGGG - Intergenic
955561443 3:60195266-60195288 GACATGGATGTGGTAAAAAAGGG + Intronic
959967677 3:112375316-112375338 GGCATGGATGAGATCACACAGGG - Intergenic
960902902 3:122569839-122569861 GACATGGCTTTGTTGATACAAGG - Exonic
962418449 3:135205211-135205233 GACATTGATATCTTTTCACATGG + Intronic
963209358 3:142672142-142672164 TACATGAATGTATATACACATGG - Intronic
966134845 3:176686495-176686517 GACATGTTTGTGTTTCAACAGGG - Intergenic
967491701 3:190099572-190099594 AACATGGATGTGTTGAACCAAGG + Intronic
968228048 3:196988276-196988298 GTGACGGATGTGTGTACACAAGG - Intergenic
970378839 4:15484825-15484847 GACATGGATGTATGGATACAGGG + Intronic
972163459 4:36253903-36253925 TACATGGAAATGTATACACATGG - Intergenic
972165668 4:36281200-36281222 AAGCTGGATATGTTTACACATGG - Intergenic
973241293 4:47958321-47958343 CTCATTGATGTCTTTACACAGGG - Intronic
974796106 4:66752312-66752334 AACATGGCTGTCTTTACACCAGG - Intergenic
975225711 4:71869584-71869606 GAGATGAATGTGTTTATAAAAGG - Intergenic
977448868 4:97168329-97168351 GAAATGGAGGAGATTACACAAGG - Intergenic
977512115 4:97974248-97974270 GGAATGGGTGTGTTTACCCAAGG + Intronic
978454380 4:108871911-108871933 GGCATGGATATGTTGACTCATGG + Intronic
980479521 4:133369784-133369806 CAAATGTATGTGTTTACATAGGG - Intergenic
981976784 4:150739727-150739749 GCCATGGAGGCCTTTACACAGGG - Intronic
982072777 4:151709951-151709973 GACAGGGTTGTGTATACAGAAGG - Intronic
983803928 4:171969353-171969375 GAAATGGATTTGATTCCACAAGG + Intronic
984584934 4:181552902-181552924 CACACGCACGTGTTTACACATGG - Intergenic
985190914 4:187371717-187371739 GAGATGGATGGGTTTCCACAAGG + Intergenic
986474322 5:8111606-8111628 CACATGAATGAGTTTAAACATGG - Intergenic
986598737 5:9450059-9450081 GACATCGGTATGTTTGCACAGGG - Intronic
990654749 5:57942625-57942647 TACAGGGATGTGTTTAGAGAAGG + Intergenic
995840655 5:116440472-116440494 TGCATGGATGTGTTTGCAGAGGG + Intergenic
999354218 5:150909214-150909236 TATATGGAAGTGATTACACAAGG + Intergenic
999703623 5:154250957-154250979 GACATGTTTGTGTTGAGACAGGG - Intronic
1000949622 5:167464998-167465020 GACATTGATGTGTTTACCGTGGG + Intronic
1001813599 5:174649246-174649268 GTTATGGATGTGTTTACAACTGG - Intergenic
1003166284 6:3681657-3681679 GGAATGGATATGTTTACCCAGGG + Intergenic
1004058141 6:12161819-12161841 GACCTGGAAGTGTCTACAGACGG - Exonic
1004987708 6:21101565-21101587 GACAGGGATGGGATCACACAGGG - Intronic
1007555847 6:42765489-42765511 TCCATGTATGTGTTTAAACATGG + Intronic
1007804455 6:44429734-44429756 GAGATGGAAGTGGTTAAACAAGG + Exonic
1012542862 6:100381999-100382021 GACATGGGTATATTTAAACAAGG + Intergenic
1014299954 6:119668909-119668931 AAGATGCATGTGTTTACAAATGG - Intergenic
1016227407 6:141756006-141756028 GACATGGATGAGATTGCAAAAGG + Intergenic
1017505108 6:155061179-155061201 GATATAAATGTGTGTACACATGG - Intronic
1017753015 6:157506185-157506207 GACATGGATGTTTCTAAAGAGGG - Intronic
1017822986 6:158062124-158062146 GACTTCGATGTGTTCACAAAGGG + Exonic
1018074663 6:160201035-160201057 GACAGGGTTTTGTTTTCACAAGG - Intronic
1020461464 7:8433893-8433915 GAGCCGGATCTGTTTACACAGGG + Intergenic
1021234572 7:18126565-18126587 AATATAGATGTGTTTACAGATGG - Intronic
1022177561 7:27886378-27886400 GACCTGGATGTGTTGACTAAAGG - Intronic
1022907050 7:34867543-34867565 GACTTGGATGTGTTTCCAGTGGG - Intronic
1026857038 7:73762021-73762043 GACACAGATGTGTGTGCACATGG + Intergenic
1028247450 7:88498312-88498334 GCTGAGGATGTGTTTACACAAGG + Intergenic
1033651528 7:143347124-143347146 GACATGGAGGTGTTCTCAGAAGG + Intronic
1034312828 7:150104583-150104605 GCCATGGATGAGTTAACAGATGG - Intergenic
1034794031 7:153996082-153996104 GCCATGGATGAGTTAACAGATGG + Intronic
1037472620 8:19225332-19225354 GACCTGTATTTGTTTACAAAGGG + Intergenic
1038067690 8:23980366-23980388 GAGAAGGATTTGTTCACACAGGG + Intergenic
1038544232 8:28412927-28412949 GGCAGGGATGGGTTTACAGATGG - Intronic
1040645094 8:49388493-49388515 GAAATGGGTGTATTTACCCAAGG + Intergenic
1041563618 8:59249168-59249190 AACCTGGATGAGTTTATACAGGG - Intergenic
1043455130 8:80405133-80405155 GAGATGGGTGTGGTTATACAAGG + Intergenic
1043658414 8:82703230-82703252 TTCAGTGATGTGTTTACACAGGG - Intergenic
1044282541 8:90373307-90373329 GACAGAGATGTGTGTGCACATGG + Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1052365175 9:27604335-27604357 GAAATGGAAATGTTTACAGATGG + Intergenic
1053476994 9:38389576-38389598 TCCAGGGATGTGTTTACACTGGG - Intergenic
1061573921 9:131494581-131494603 GGCATGGCTGTCTTTAGACAGGG - Intronic
1186322713 X:8447507-8447529 GTGATGGATGCGTTTAGACAAGG + Intergenic
1186769237 X:12801502-12801524 GACATGGATGTGATATGACAAGG - Intronic
1187324121 X:18270754-18270776 GAAATGGATTTGTTTAAATAAGG + Intronic
1187939811 X:24370776-24370798 TTGATGGATGTGTTGACACATGG - Intergenic
1195704615 X:107729811-107729833 GACATGGATGTGTTTACACAGGG - Intronic
1195775885 X:108405638-108405660 GGAATGGATGGGTTTACTCAAGG - Intronic
1200844888 Y:7821849-7821871 GGCAAGAATGTGTTTTCACATGG + Intergenic