ID: 1195709309

View in Genome Browser
Species Human (GRCh38)
Location X:107761283-107761305
Sequence CAGGAAGTTCTAGCCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195709309_1195709311 -8 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709311 X:107761298-107761320 ACTTCCTGCCCCTCTGAAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 223
1195709309_1195709312 -7 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709312 X:107761299-107761321 CTTCCTGCCCCTCTGAAAGAGGG 0: 1
1: 0
2: 0
3: 23
4: 268
1195709309_1195709319 12 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709319 X:107761318-107761340 AGGGACAGGGAAAAACAGACTGG 0: 1
1: 0
2: 4
3: 73
4: 653
1195709309_1195709320 13 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709320 X:107761319-107761341 GGGACAGGGAAAAACAGACTGGG 0: 1
1: 0
2: 3
3: 43
4: 413
1195709309_1195709321 29 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709321 X:107761335-107761357 GACTGGGACCCCATCTCTCTAGG 0: 1
1: 0
2: 2
3: 21
4: 220
1195709309_1195709315 -1 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709315 X:107761305-107761327 GCCCCTCTGAAAGAGGGACAGGG 0: 1
1: 0
2: 1
3: 18
4: 186
1195709309_1195709314 -2 Left 1195709309 X:107761283-107761305 CCCACAAGGGCTAGAACTTCCTG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1195709314 X:107761304-107761326 TGCCCCTCTGAAAGAGGGACAGG 0: 1
1: 0
2: 2
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195709309 Original CRISPR CAGGAAGTTCTAGCCCTTGT GGG (reversed) Intronic
904972025 1:34426660-34426682 CAAGAAGTTCTGGTCCTGGTTGG + Intergenic
915031464 1:152883483-152883505 CAGGAAGTCCAAGCTCTTCTGGG - Intronic
917268448 1:173246940-173246962 AATGAAGATCTAGCCCTTATAGG - Intergenic
922766189 1:228157763-228157785 CAGGAAGCTCCAGCTCATGTTGG - Exonic
1063164206 10:3445085-3445107 GAGCAAGTTCTAGCCCTCCTGGG + Intergenic
1065782556 10:29183631-29183653 CAGGAAGTGCTGGACCTTGGGGG + Intergenic
1070808452 10:79285005-79285027 CAGGAAGATGCAGCCCTTCTTGG + Intronic
1074472036 10:113735985-113736007 CAGGAATGCCAAGCCCTTGTTGG + Intergenic
1075828787 10:125385074-125385096 TAGGCAGCTCTAGCCTTTGTTGG - Intergenic
1077025306 11:437404-437426 GGGGAAGTTCTTGCCCTAGTTGG + Intronic
1079839883 11:25383135-25383157 TAGGTGGTTCTAGCCTTTGTTGG - Intergenic
1081054033 11:38385737-38385759 GAGGAATTTGTAGCCATTGTAGG + Intergenic
1082254262 11:50015066-50015088 CAGAATGTTCTAGTCATTGTGGG - Intergenic
1082624652 11:55468368-55468390 CAGCAAGTTCTGGCTCTTTTAGG + Intergenic
1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG + Intronic
1087609581 11:100417832-100417854 CAGGAAGTTTTGCCCCCTGTGGG - Intergenic
1089806509 11:121095387-121095409 CATGAAGACCTAGGCCTTGTTGG - Intergenic
1091467179 12:694836-694858 CAGGAGGTCTTACCCCTTGTTGG + Intergenic
1092672303 12:10877698-10877720 GAGGAAGTTCCAGTCCTGGTGGG + Intronic
1093670042 12:21862756-21862778 CTGGAAGTTCCAGCCCATCTTGG - Intronic
1093751584 12:22806207-22806229 TCAGAAGTTTTAGCCCTTGTAGG + Intergenic
1094726978 12:33130164-33130186 TTGGAAGTACTAACCCTTGTAGG - Intergenic
1096999887 12:55867606-55867628 CTGGAAGTTTTATCCCTTGATGG + Intergenic
1097061872 12:56291219-56291241 CAGGAAGTTCTGACACTTGATGG - Intronic
1097150989 12:56979727-56979749 CAGAATGTTGTAGCCCTTGGTGG + Intergenic
1098502909 12:71214670-71214692 CAGGAAGTCCTAGCACCTGGAGG + Intronic
1102576913 12:113861401-113861423 TAGGAGATTATAGCCCTTGTGGG - Intronic
1114400522 14:22406139-22406161 CATGAAGTTCTGGCCCGTGATGG + Intergenic
1115420723 14:33192010-33192032 GTGGAAGTTCTAACCATTGTGGG - Intronic
1119294545 14:73522442-73522464 CAGGAAGCTCTGCCACTTGTTGG + Exonic
1122102056 14:99420541-99420563 CAGAAAGCTCCAGCCCATGTGGG + Intronic
1127657194 15:61066760-61066782 CAAGAAGTTCCAGCTCTTTTTGG + Intronic
1129612108 15:77069683-77069705 TATGAAGTTTTATCCCTTGTTGG + Intronic
1130554543 15:84913628-84913650 AAGGAAATTCTAGCTCTTCTAGG - Intronic
1132358058 15:101187926-101187948 CAGGAACTTCTAGCCCAGCTGGG + Intronic
1135010801 16:18876255-18876277 CAGGAAGTTGTAGACTGTGTAGG + Exonic
1137745776 16:50818989-50819011 AAGGAAGTTCTACCCCTTCTAGG + Intergenic
1140323712 16:73979263-73979285 GAGAAAGTTCTAGTACTTGTAGG - Intergenic
1141488487 16:84356263-84356285 CAGGAGGTTCTAGCCTTTGGTGG - Intergenic
1141852849 16:86659143-86659165 CAGGAAGTCCTGTCCCTTCTAGG + Intergenic
1144536748 17:16097380-16097402 CTGAAAGTTCCAGCCCTTGCTGG - Intronic
1147663873 17:42133049-42133071 CAGGAAGGTCTAGCTCTAGCTGG + Intronic
1151703116 17:75753772-75753794 CTGGAAGTTCGAGCCCCTGCTGG + Exonic
1151814660 17:76465789-76465811 TGGGAAGTTCAAACCCTTGTGGG - Intronic
1159859054 18:73625587-73625609 CAGGAACCTCTAGCCGTTTTGGG - Intergenic
1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG + Intronic
1162914490 19:13866564-13866586 CTGGATGTCCGAGCCCTTGTGGG - Intronic
1167981198 19:53277074-53277096 CTGGAGATTCTGGCCCTTGTGGG - Intergenic
925634909 2:5933716-5933738 CAGCAGGTGCTAGCCCTGGTGGG + Intergenic
930884297 2:56306937-56306959 CAGGAAATTTTAGCCCATTTTGG + Intronic
932307689 2:70715601-70715623 CAGTACATTCTAGTCCTTGTTGG + Intronic
936010742 2:108923809-108923831 CAGGAAGGTCTGGCCTTGGTTGG - Intronic
936376814 2:111947971-111947993 CAGGAAGTGTGAGCCCTTGGGGG + Intronic
937033214 2:118758463-118758485 CAGGAAGCTATAGCCATTCTTGG + Intergenic
938213698 2:129490339-129490361 CAGGAAGTTCTAGAATTTGGTGG + Intergenic
941191112 2:162383633-162383655 TAGGATGTTCTAGGCCTGGTAGG - Intronic
941677113 2:168355685-168355707 CAAGAAGTTCTAGGACTTGCTGG + Intergenic
943333479 2:186587777-186587799 CAGTAAGTTGTAGCCCTATTTGG + Intergenic
944289967 2:197993926-197993948 CAGGATCTTCTACCCATTGTTGG + Intronic
944872648 2:203930182-203930204 CATGAAATTCTAGTCTTTGTGGG - Intergenic
1168946879 20:1768143-1768165 CAAGAAGTTCTAGAGCTTGCAGG + Intergenic
1169584138 20:7060880-7060902 CAGGAATTTCTAACCACTGTTGG + Intergenic
1176070262 20:63222579-63222601 CAGGTAGATCCAGCCATTGTGGG - Intergenic
1176272775 20:64245066-64245088 CAGGCAGTTGTGGCCCCTGTTGG - Intergenic
1176389971 21:6158374-6158396 GAGGAAGTGCCAGCCCTTCTGGG - Intergenic
1176410903 21:6448936-6448958 CAGAATGTTCTAGCTCTTGTTGG + Intergenic
1176914698 21:14610758-14610780 CAGGGAGTTCTAGTCCTTCATGG + Intronic
1177283732 21:19020984-19021006 GAGTGAGTTCTTGCCCTTGTGGG + Intergenic
1178310943 21:31529570-31529592 CAGGGAGTTTAAGACCTTGTGGG + Intronic
1179193237 21:39141146-39141168 CAGAAAGTTCTATTCCTTTTGGG - Intergenic
1179494395 21:41762500-41762522 TAGGAAGCTCCAGCCCTTCTGGG + Intronic
1179686396 21:43057258-43057280 CAGAATGTTCTAGCTCTTGTTGG + Intronic
1179733495 21:43379866-43379888 GAGGAAGTGCCAGCCCTTCTGGG + Intergenic
1180982563 22:19885678-19885700 CAGGAAGTGCTGGGCCTGGTGGG - Intronic
1181745057 22:24950458-24950480 CAGGAAGTCCTGCCCCTTCTGGG + Intergenic
1182254288 22:29027157-29027179 GAGGTAGATCTAGCCTTTGTAGG - Intronic
1182265686 22:29113276-29113298 CAGGAAGCTCTAGCCCCTTCAGG - Intronic
1182294124 22:29303209-29303231 CAGGAAGCTCTGGCACTGGTTGG - Intergenic
1182351254 22:29701206-29701228 GTGGAAGGTCTGGCCCTTGTGGG - Intergenic
1182773701 22:32815254-32815276 AAGTAACTTCTAGGCCTTGTGGG + Intronic
950611344 3:14128619-14128641 AGGGCAGTGCTAGCCCTTGTGGG - Intronic
959599699 3:108167459-108167481 CTGTAAGTTCTAGACCTTGCTGG + Intronic
962726226 3:138230263-138230285 TGGGAAATTCTAGCCCTTGATGG - Intronic
965079158 3:164016655-164016677 CAGGTAGTTGCTGCCCTTGTAGG - Intergenic
966505050 3:180691499-180691521 TAGGAAGTTCTATCCCTTTACGG - Intronic
969149733 4:5159074-5159096 CAGTGAGTTCTAGCCCGTGTTGG - Intronic
979983839 4:127291547-127291569 CAGTAAGTTCTGGCAATTGTGGG - Intergenic
985704318 5:1391735-1391757 CAGGCAGGTTCAGCCCTTGTAGG + Intergenic
993653001 5:90544475-90544497 CAGGAAGACCTAGCCCATGTTGG + Intronic
994224373 5:97235385-97235407 TAGGAAGTTCTGGCCAGTGTTGG + Intergenic
999500066 5:152137971-152137993 TTGGAAGTTCTAGCTCCTGTTGG + Intergenic
999925864 5:156376378-156376400 TAGGAAGTGCTAACCCTGGTTGG + Intronic
1002770349 6:285339-285361 CAGGAAGCTCTCGGCATTGTTGG - Intergenic
1003735404 6:8872715-8872737 CAGGAACTTTTCTCCCTTGTTGG + Intergenic
1007221150 6:40279954-40279976 CAGGAAGGTCTGGGCCTTGAGGG - Intergenic
1007976877 6:46110675-46110697 CAGGAACTTCAAGATCTTGTGGG + Intergenic
1009928331 6:70146859-70146881 CAGGAATTCCTATCCCTTGTGGG - Exonic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1017468046 6:154713218-154713240 AAGAAAGTTCTGGCCCTTGATGG + Intergenic
1020201608 7:6084358-6084380 CAGTAACTTTTAGTCCTTGTTGG + Intergenic
1020276694 7:6628821-6628843 CTGGAATTTCTTGCCCTGGTGGG + Intergenic
1020590976 7:10136706-10136728 CTGGAAGTTCTATGCCTTCTGGG + Intergenic
1023785686 7:43705612-43705634 TAGGCAGCTCTAGCCTTTGTTGG - Intronic
1030370574 7:108694771-108694793 CAGAATGTTGTAGCCCTTGGTGG + Intergenic
1030495354 7:110291857-110291879 CAGGAAATTCTAATCCTTTTAGG + Intergenic
1033106409 7:138530046-138530068 CAGAAAGTTCTATCCCTTCTGGG + Intronic
1034098987 7:148435785-148435807 CAGGAAGGCCCAGCCCTTCTGGG + Intergenic
1034116001 7:148584191-148584213 AATGAACTTCTAGCTCTTGTAGG + Intergenic
1034761756 7:153679230-153679252 CATGAAGTTCTTCCCCTTGGGGG + Intergenic
1040616439 8:49042604-49042626 CAGGGAGTATTAGCCCTTTTAGG + Intergenic
1041401893 8:57454999-57455021 CAGGAACTTATAACCTTTGTGGG + Intergenic
1045816594 8:106283753-106283775 CAGGAAGTTTTGGCTCTTTTAGG + Intronic
1058682697 9:107454118-107454140 TAGGCAGTTCCAGACCTTGTAGG + Intergenic
1058805977 9:108592267-108592289 CAGTAAGTGCTAGGCTTTGTGGG + Intergenic
1059648724 9:116294248-116294270 GAGGAATTTCTGGCCCATGTGGG + Intronic
1189175724 X:38955462-38955484 CAGGGATTTCTAGCCTTTCTTGG - Intergenic
1191163926 X:57366871-57366893 CAGGCAGCTCTAGCCTTTGTTGG - Intronic
1191853225 X:65601618-65601640 CTGGAAGATCTAACCCTGGTGGG + Intronic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1195239517 X:102937338-102937360 CAGGAAGTCGTAGGCCTGGTCGG - Exonic
1195298189 X:103500715-103500737 CAGGAAGTCATAGGCCTGGTCGG + Exonic
1195709309 X:107761283-107761305 CAGGAAGTTCTAGCCCTTGTGGG - Intronic
1195808337 X:108801009-108801031 CAGGAAGTGCAAGGCCTTGGGGG + Intergenic
1196354352 X:114772650-114772672 CTGGAATTACTAGCCTTTGTTGG - Intronic
1197292098 X:124671117-124671139 CAGGTAGTTCAAGCTCATGTTGG + Intronic