ID: 1195712806

View in Genome Browser
Species Human (GRCh38)
Location X:107788110-107788132
Sequence CCTAAAAAGTAGAGCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195712806_1195712811 26 Left 1195712806 X:107788110-107788132 CCAACCAAGCTCTACTTTTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
Right 1195712811 X:107788159-107788181 CAGATCAACTTGGTGATCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 116
1195712806_1195712810 16 Left 1195712806 X:107788110-107788132 CCAACCAAGCTCTACTTTTTAGG 0: 1
1: 0
2: 2
3: 11
4: 117
Right 1195712810 X:107788149-107788171 ACAGTGTTTACAGATCAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195712806 Original CRISPR CCTAAAAAGTAGAGCTTGGT TGG (reversed) Intronic
900834576 1:4990511-4990533 AGTAAAAAGTATAGCTTGGAGGG - Intergenic
901865319 1:12102820-12102842 CATAAAAAGTACAGCTAGGCGGG - Intronic
904951885 1:34249083-34249105 CAAAAAAAGTAGAGCAGGGTGGG - Intergenic
904979000 1:34480522-34480544 CCTAAAAGGTAAAGCTTGGCTGG - Intergenic
906393848 1:45443202-45443224 CCTTAAAAATAGACCTTAGTTGG - Intronic
910150055 1:84131981-84132003 CCTACAGAGTAGACCTTTGTTGG - Intronic
911528671 1:99017085-99017107 CCTAGAAAGTGGAGTTTGGCAGG + Intergenic
919734987 1:200942666-200942688 ACTAAAAGGTAGAGATTGTTAGG - Intergenic
1064708365 10:18096452-18096474 CTTAAGAAGTAGGGGTTGGTTGG + Intergenic
1064882168 10:20067844-20067866 CCAAAATAGTAGAGCATGTTAGG - Intronic
1066441645 10:35445157-35445179 CTTAAAAGGTAGATTTTGGTGGG + Intronic
1068334503 10:55614835-55614857 CCTACGAAGTAAACCTTGGTTGG - Intronic
1070155012 10:73827888-73827910 CCTAAAAAGTGGACATTGGAAGG - Intronic
1073576339 10:104628904-104628926 TCTAAAAAGTAGTCCTTGTTGGG - Intergenic
1074075783 10:110122925-110122947 CTTAAAAAGTTGAACTTGTTGGG - Intronic
1074097707 10:110328625-110328647 CCTAGATAGGAGAGCATGGTTGG - Intergenic
1078563164 11:12390612-12390634 CCTGCAAAGTAGAGGTCGGTGGG + Intronic
1081878823 11:46430230-46430252 CCAAAAAAGCTGAGTTTGGTAGG + Intronic
1082210858 11:49499114-49499136 TCTAAAGAGTAGTGCTTGGGGGG + Intergenic
1085160375 11:74337474-74337496 ACAAAATAGTATAGCTTGGTTGG + Intronic
1087716392 11:101613529-101613551 CCAAAGAAGCAGAGCTGGGTAGG + Intronic
1090353140 11:126120673-126120695 CTTAAAGAGGAGAGCTTGGCGGG + Intergenic
1092666148 12:10801134-10801156 TCCCAAAAGTAGAGCTTTGTTGG + Intergenic
1093118344 12:15238141-15238163 TCTAAAAAAAATAGCTTGGTGGG + Intronic
1102464506 12:113120552-113120574 CCTAAAAATGAGAGCTGGGGAGG + Intronic
1107670172 13:42737366-42737388 TGTAAAAAGAAGAGCTTTGTGGG + Intergenic
1110082875 13:71338524-71338546 ACTAAAAAGTAGCTCTTGGGAGG - Intergenic
1115226087 14:31103669-31103691 CTTAAAAAGTTGATCTTGGCCGG + Intronic
1116324502 14:43514988-43515010 CCTAAAAAGTGGGGCTTCGTGGG - Intergenic
1118803877 14:69217348-69217370 CTAAAAAAGTTGACCTTGGTGGG - Intronic
1126745116 15:51818055-51818077 CATAAAATGGAGAGCTTTGTTGG - Intergenic
1126985212 15:54298573-54298595 CCCAAAAAGTAGGGCCTAGTTGG + Intronic
1127244417 15:57156320-57156342 CCTAAAAAATAGAGTGAGGTGGG - Intronic
1127683735 15:61321764-61321786 CCTAGAAAGTAGAGCTTATTAGG - Intergenic
1129708442 15:77807969-77807991 CCTAGAATGTGGAGCTGGGTGGG - Intronic
1131428544 15:92367585-92367607 CCTAAAATGTACAGCTAGGATGG + Intergenic
1133849341 16:9487308-9487330 TCTAAAAAGTAAGGGTTGGTTGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1137379800 16:47986707-47986729 CCTGAAAAGAAGATCTGGGTGGG + Intergenic
1140621942 16:76745642-76745664 CCCAAAATGTAGACCTTAGTAGG - Intergenic
1142882274 17:2890980-2891002 CATAAAAAGTAAACATTGGTCGG - Intronic
1144537053 17:16100827-16100849 CCTAATAAGTAGGGGCTGGTAGG + Intronic
1145190289 17:20835774-20835796 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1145401502 17:22539652-22539674 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1147618846 17:41848809-41848831 CGTGAAAAGTAGTGCTTGCTAGG - Intergenic
1149625743 17:58079467-58079489 ACTGAAAAGTACAGCTTGGAAGG - Intergenic
1158405915 18:57158968-57158990 CCTTAAAAGTAGAAATTGGGAGG - Intergenic
1160220238 18:76971284-76971306 GGGAAAAAGTAGAGCTTGATGGG - Intergenic
1164183598 19:22841572-22841594 CCTCTAGAGTAAAGCTTGGTTGG - Intergenic
1164240099 19:23379303-23379325 CCTCTAGAGTAGAGCTTGGTTGG + Intronic
1164284421 19:23800439-23800461 CCTCTAGAGTAAAGCTTGGTTGG - Intronic
1165161537 19:33819809-33819831 CTTAAAAAGCAGAGCCTGGGAGG + Intergenic
926884727 2:17586353-17586375 CCTTAAAAATACAGCTTAGTGGG - Intronic
927379464 2:22461981-22462003 CCTAATGAGTAAAGCCTGGTAGG + Intergenic
929073671 2:38059588-38059610 CAGAAAAAGTAGAGCAAGGTAGG + Intronic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
934041870 2:88133903-88133925 CATGTAAAGGAGAGCTTGGTGGG - Intergenic
934706976 2:96488406-96488428 CCAACAAAATAGAACTTGGTTGG - Intergenic
937895751 2:126975856-126975878 ACCAAAAAGTAGAGTTTGGAAGG + Intergenic
941190659 2:162377700-162377722 CCTGAAAAATAGAGCTGGGGAGG - Intronic
942460130 2:176162808-176162830 CCTCAAAAGAAGAGCTAAGTTGG - Intronic
945079446 2:206074003-206074025 ATTAAAAAGTAGAGTTTGGCTGG - Intronic
945182188 2:207103222-207103244 CTTTAAAAGTACAGCTTGATTGG - Intronic
946174617 2:217914866-217914888 TCTGCAAAGTAGAACTTGGTAGG - Intronic
1169906986 20:10614369-10614391 CCTAAAAACAAGAGTTTGGTGGG + Intronic
1176945239 21:14972363-14972385 ACTAAATAGTACAGCTTGTTGGG + Intronic
1177175999 21:17701403-17701425 CCTACAAAGGACAGCTTTGTAGG + Intergenic
1178450639 21:32696149-32696171 CCTTAAAAGTAGAGCTTCATGGG - Intronic
1180125541 21:45787750-45787772 ACTAGACAGTAGAGTTTGGTTGG + Intronic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
949787750 3:7760324-7760346 CGTAAAAAGCTGAGCTTGTTTGG - Intergenic
950004777 3:9684688-9684710 CCCAAAGAGCAGAGCTTGGTAGG - Intronic
951850357 3:27132966-27132988 CCTAGAAAATAGAGCAGGGTTGG - Intronic
956067326 3:65411115-65411137 CTTAAAAAGTAGATCTTGGTAGG - Intronic
958904062 3:99922796-99922818 GCAAAAAAGGAGAGTTTGGTTGG - Intronic
959662638 3:108886470-108886492 CCTAAATATTAGCACTTGGTAGG + Intergenic
960250112 3:115442419-115442441 CCTAAAGAATCCAGCTTGGTTGG - Intergenic
960533383 3:118790197-118790219 CTAAGAAAGTAGAACTTGGTTGG + Intergenic
961990669 3:131186763-131186785 ATTAAAATATAGAGCTTGGTAGG + Intronic
962649119 3:137470901-137470923 CCTAAGTAGTAGAGCAAGGTTGG + Intergenic
962846059 3:139274914-139274936 CAAAATAAGTAGAGCTTGGTGGG - Intronic
967901228 3:194454531-194454553 CCTAAAAAGTAGGGCAGGCTGGG + Intronic
971105853 4:23523968-23523990 CCTAAGAAGGAGATCCTGGTGGG + Intergenic
971760118 4:30755066-30755088 GCTAAGATGTAGAGCTGGGTTGG + Intronic
978709545 4:111762460-111762482 CCTAAAAAGTAGAGCTTAGGGGG + Intergenic
982495163 4:156082121-156082143 GCAGAAAAGTAAAGCTTGGTAGG - Intergenic
987462930 5:18235452-18235474 CCTACAAAGTATAGCTTTGCAGG + Intergenic
988119657 5:26944354-26944376 TCTAAAAAGGATAACTTGGTTGG + Intronic
988833312 5:35007805-35007827 CCTAAAAAGAGGTGCTTGGGTGG + Intronic
991638903 5:68733944-68733966 CCTGAACAGTAGAACTAGGTAGG + Intergenic
995765058 5:115605349-115605371 CCCAAAATGTTGGGCTTGGTGGG + Intronic
997988027 5:138519783-138519805 TCTAAAAACTTGAGTTTGGTTGG - Intronic
998012075 5:138703417-138703439 CCTAAAAGGCAAAGTTTGGTAGG - Intronic
998884601 5:146680944-146680966 CATAAAAACAAGATCTTGGTTGG - Intronic
1000031514 5:157406135-157406157 CCTAAGAAGTAGCTCCTGGTGGG + Intronic
1005965692 6:30724961-30724983 CCTCCAGAGTAGAGCTTGGAGGG - Exonic
1008931554 6:56945719-56945741 GCCAGAAAGTAGTGCTTGGTTGG + Intronic
1010122989 6:72400736-72400758 CCTGAAAAGTAGAGTTTTATTGG - Intronic
1011676471 6:89739194-89739216 CCTAACAAGCAGAGCAAGGTAGG - Intronic
1011834850 6:91419506-91419528 CCTGAATATTAGACCTTGGTTGG - Intergenic
1017563852 6:155663088-155663110 CCAAAAAAGTAGAGCTGGGAAGG + Intergenic
1021078386 7:16333538-16333560 CCACAAAAGCAGTGCTTGGTGGG + Intronic
1025774768 7:64550837-64550859 CCTCTAGAGTAAAGCTTGGTTGG + Intronic
1030585228 7:111410356-111410378 CCAAAAAAGTGGAGGGTGGTGGG + Intronic
1031159633 7:118150865-118150887 TCTAAACTGTAGAGGTTGGTAGG + Intergenic
1032149542 7:129416429-129416451 AAGAAAAAGTAGAGCATGGTGGG + Intronic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1035916917 8:3634872-3634894 CCTAGATAGTAGAGCCTGCTGGG + Intronic
1039030991 8:33309422-33309444 CTTAGAAATGAGAGCTTGGTTGG + Intergenic
1039252271 8:35679744-35679766 CCTAGAAAGAAGATCATGGTAGG + Intronic
1040633159 8:49239560-49239582 CTTAAAAATGAGAGCTTAGTAGG + Intergenic
1041527645 8:58824875-58824897 GGGAAAAAATAGAGCTTGGTTGG + Intronic
1041550828 8:59099019-59099041 ACTAAAAAGTACAGCAAGGTAGG - Intronic
1042442083 8:68840399-68840421 TCTAAAAATTAGAGCTTTTTAGG + Intergenic
1044661701 8:94597951-94597973 CTTATAAAGTAGAGCTTTCTAGG + Intergenic
1046221650 8:111224800-111224822 CCTAAAATGTAAAGCTTTTTTGG + Intergenic
1046425898 8:114048678-114048700 CATAAAAATTAGAGATAGGTAGG - Intergenic
1050623117 9:7475347-7475369 ACTAAAAACTAGATCTTGGGTGG - Intergenic
1052407559 9:28081426-28081448 CCTAAATTTTAGAGCTTGGTAGG + Intronic
1052411861 9:28131598-28131620 CCTAAATAGTAGAGTTTAGCTGG + Intronic
1052938619 9:34114264-34114286 CTTAAAAAGTTGATCTTGGCTGG + Intronic
1056699650 9:88891767-88891789 GCTAAACAGTGGAGCTTGGGAGG - Intergenic
1060341173 9:122778361-122778383 CCTAAATAGTGGAGGTGGGTGGG - Intergenic
1061688938 9:132308840-132308862 CTCAAAAAGTAGAGCAAGGTAGG + Intronic
1062608380 9:137359263-137359285 CTTAAAAAGTAGGCCTTGGCCGG - Intronic
1187091595 X:16102565-16102587 CCTCAAAGGTAAACCTTGGTTGG + Intergenic
1191923807 X:66287080-66287102 TTTGAAAAGTAAAGCTTGGTGGG + Intergenic
1192891689 X:75398184-75398206 CCTAAAAAGGAGCTCCTGGTGGG + Intronic
1193523650 X:82561497-82561519 CCTAAAAAGTAGAGTATGTGAGG + Intergenic
1195712806 X:107788110-107788132 CCTAAAAAGTAGAGCTTGGTTGG - Intronic
1199877901 X:151949361-151949383 CCTAATAGATAGGGCTTGGTTGG + Intergenic