ID: 1195715732

View in Genome Browser
Species Human (GRCh38)
Location X:107817076-107817098
Sequence GCTATGTAGTGCATTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195715732_1195715733 -5 Left 1195715732 X:107817076-107817098 CCTGAGAGAATGCACTACATAGC No data
Right 1195715733 X:107817094-107817116 ATAGCCATGAGAAGATTAGAAGG No data
1195715732_1195715735 15 Left 1195715732 X:107817076-107817098 CCTGAGAGAATGCACTACATAGC No data
Right 1195715735 X:107817114-107817136 AGGAAGAGCACTCCAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195715732 Original CRISPR GCTATGTAGTGCATTCTCTC AGG (reversed) Intergenic
No off target data available for this crispr