ID: 1195718595

View in Genome Browser
Species Human (GRCh38)
Location X:107843384-107843406
Sequence CCCTCATCTCCAGGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195718589_1195718595 24 Left 1195718589 X:107843337-107843359 CCGAAAACATGATGATTGATTAG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG 0: 1
1: 0
2: 3
3: 33
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195718595 Original CRISPR CCCTCATCTCCAGGGATGGA TGG Intronic
900095626 1:938993-939015 CCTGCATCTCAAGGAATGGAAGG - Intronic
900118655 1:1039394-1039416 CCCCCATCTCCAAGGAGGGTGGG - Intronic
900160275 1:1220013-1220035 ACCGCAGCTCCTGGGATGGATGG + Intronic
900686887 1:3954409-3954431 TCCTCGTCTCCAGGCATGGGAGG + Intergenic
900905109 1:5551617-5551639 CCCTCATCTCCTGGCAGGCAGGG + Intergenic
901061548 1:6474140-6474162 CCCTCATCTCCAGGCTTGGCTGG + Exonic
901170137 1:7250996-7251018 CCCTCATCTCCTACGCTGGAGGG + Intronic
903140773 1:21337957-21337979 CCCTCCTCTCCAGTGCTGGAAGG + Intronic
903350474 1:22713537-22713559 CCTTCAAAGCCAGGGATGGACGG + Intronic
903813995 1:26051261-26051283 CCCTCATCTCCAGGAAAAAAAGG + Intergenic
904941534 1:34167129-34167151 TCCTCCTCTCCAGGGCTGGTGGG - Intronic
906036536 1:42753970-42753992 CCCTCATGGGCAGGGATGGTGGG + Intronic
906251672 1:44315323-44315345 GCCTTATCTCCAGGGAGGGAGGG - Intronic
907481583 1:54748667-54748689 CACTCCACTCCAGGGATGGCGGG - Intergenic
907515323 1:54990100-54990122 CCCTCATCTGCAAGGATGCTGGG + Intronic
913212292 1:116591681-116591703 CCCACATCTCCAGGGCAGGTAGG + Intronic
914437923 1:147676652-147676674 CCTTCAACTTCAGGGATGGTTGG - Intergenic
914915454 1:151816498-151816520 TCCTCCCCTCCAGGGATGGATGG - Intronic
915405974 1:155660006-155660028 GCCTTATCTTCAGGGGTGGATGG + Exonic
915419138 1:155765799-155765821 GCCTTATCTTCAGGGGTGGATGG + Exonic
917104432 1:171478207-171478229 CCCACATTTGCAGGGATGGTGGG - Intergenic
919732384 1:200921571-200921593 GCCTCTCCTCCAGGGAAGGAGGG - Intergenic
919876214 1:201870755-201870777 CCCTCATCTCCAAGGCAGGGCGG + Exonic
920099296 1:203507071-203507093 CCCTCTGCACCAGGGAGGGAAGG + Intronic
920177029 1:204108444-204108466 CCATCAGCTCCAGGGATGGATGG + Intronic
920302616 1:204998051-204998073 CCCTCAAATGCAGGCATGGAGGG + Intronic
920415552 1:205797082-205797104 CCTTCATCTCCAAGGATAGGTGG - Intronic
921595037 1:217045548-217045570 CCCTGATCTCCTGAGATGGCTGG + Intronic
923041675 1:230324076-230324098 CCTTCATCTGCAGGGATGGTGGG - Intronic
923714102 1:236410477-236410499 CCACCATCTCAAGGGATGGTTGG - Intronic
924253588 1:242159639-242159661 CCCTACCCTCCAGGGTTGGAGGG + Intronic
1064236484 10:13580780-13580802 CCCTCATCTGCAGGGAACAAGGG - Intergenic
1064292717 10:14050631-14050653 CCCTGACCTCCAGGGAGGGCAGG + Intronic
1064552734 10:16520310-16520332 CCCGCCTCTCCAGGGTGGGACGG + Intronic
1065123186 10:22547592-22547614 CACCCATCTCCATGGATGGGGGG + Intronic
1066374397 10:34844318-34844340 CCCTAATCTCCAGGGAGGAGAGG + Intergenic
1068374914 10:56165545-56165567 CTCTAATCTCCAGTTATGGAGGG + Intergenic
1068650231 10:59514506-59514528 CCCACATATCCATCGATGGATGG - Intergenic
1069426075 10:68289747-68289769 CCATCATCTTTAGAGATGGAGGG + Intronic
1070150258 10:73800900-73800922 ACCTCAGCTCCTGGGGTGGAGGG + Intronic
1070160416 10:73863452-73863474 ATCTCAAGTCCAGGGATGGAAGG - Intronic
1070628545 10:78068146-78068168 CCCTCAGCTCCAGAGATGGGAGG - Intergenic
1070745289 10:78930058-78930080 CCTACATCTCCAGGAAAGGATGG + Intergenic
1073073295 10:100808307-100808329 CCCTCCCCTCCATGGCTGGACGG - Intronic
1074772702 10:116743604-116743626 CCCTCACTTCCAGAGATGGGTGG + Intergenic
1075070471 10:119316859-119316881 CCCTGACTTCCAGGGAGGGACGG - Intronic
1077899810 11:6479204-6479226 ACCTCATCTCCAGGGCCAGAAGG + Exonic
1080766120 11:35298740-35298762 CCCTTCTCCCCAGAGATGGAGGG - Intronic
1081285204 11:41260425-41260447 CTCTCATCTTCATGAATGGACGG - Intronic
1081542709 11:44047924-44047946 CCCTCAGGTCCAGGAATGGATGG - Intergenic
1081927807 11:46845612-46845634 CCAACACCTCCAGGGCTGGAAGG + Intronic
1084893156 11:72246641-72246663 CCCGAATGTCCACGGATGGATGG - Intergenic
1087673733 11:101135352-101135374 TCCTCACCCCCAGGGCTGGAAGG - Intergenic
1088749442 11:112831422-112831444 TCCACATCTCCAGGGGTGGAGGG - Intergenic
1089341273 11:117759455-117759477 GCCTCGTCCCCAGGGCTGGAAGG + Intronic
1090197473 11:124828975-124828997 GCCTGACCTCCAGGGAGGGAAGG + Intergenic
1090496485 11:127217687-127217709 CCCTGATCTTCTGGGATGGAGGG + Intergenic
1091188793 11:133671973-133671995 ACCTCATCTCCAGGGGTGCTGGG - Intergenic
1096241918 12:49964192-49964214 CCCTCATCTCCAGGGAGCCAGGG - Intronic
1096506936 12:52099625-52099647 TCCTAATATCCAGGGAAGGAGGG - Intergenic
1096748587 12:53744537-53744559 CCTTCATCTCCAAGGATCCAAGG - Intergenic
1099181691 12:79476994-79477016 TCCTAATATCCAGGGAGGGAGGG + Intergenic
1099894629 12:88629519-88629541 CCCTCATATGCACAGATGGATGG + Intergenic
1102190997 12:110988223-110988245 CCCTCCTCTCCAGGAATCCAAGG - Intergenic
1102491626 12:113292918-113292940 CCATCAACTGCAGGGATGGAAGG - Exonic
1103358960 12:120342499-120342521 CCCTCCTCTCCAGGGCTGGAGGG + Exonic
1105215538 13:18282304-18282326 CCCACATCTCCAGGGCAGGTAGG + Intergenic
1105290657 13:19051018-19051040 CCTTCTGTTCCAGGGATGGATGG + Intergenic
1108992774 13:56683449-56683471 TCCTCATTTTCAGGGATAGATGG - Intergenic
1114463577 14:22904101-22904123 CACTCATCTCAAGGGGTAGAAGG + Intronic
1115749714 14:36477209-36477231 TCATCATGGCCAGGGATGGAAGG + Intronic
1117037368 14:51742871-51742893 TCCTAATATCCAGGGATGGAGGG + Intergenic
1118980967 14:70716742-70716764 CCCCTATCTCCAGGGATCGACGG + Intergenic
1119692889 14:76690800-76690822 CCCTCAACTCCAAGGCTGGGGGG - Intergenic
1120733254 14:88025803-88025825 CCAGCATCTTCAGGGAGGGATGG - Intergenic
1122186624 14:100003243-100003265 GCCTCATCTTCAGGCCTGGAAGG - Intronic
1129504083 15:76066577-76066599 CCCTCTTCACCAGGGCAGGAAGG - Intronic
1130937362 15:88481751-88481773 CCCTCAGCTTCAGGGCCGGAAGG + Intergenic
1131951455 15:97685966-97685988 CCCTGCCCTCCAGGGCTGGATGG + Intergenic
1132481261 16:167256-167278 ACCTCATCCCCAGGGCTGCAGGG - Intergenic
1132618980 16:855511-855533 CCCTCATGTCCAGGGTTGCTCGG + Intronic
1132690966 16:1181736-1181758 CCCCCACCTCCAGGAATGAAAGG - Intronic
1133013059 16:2925472-2925494 CTCTGAGCTCCAGGGATGAATGG - Intronic
1134471803 16:14532720-14532742 CCCTCACCTCCCGGGAGGGGCGG + Intronic
1135560118 16:23469687-23469709 CCCACAGCTCCAGGGTTGCATGG - Intronic
1135940016 16:26814506-26814528 CCCTCATCAACAGAGAAGGAAGG + Intergenic
1136864585 16:33735710-33735732 CCCTCTTCTGCAGGGATCCATGG + Intergenic
1137695337 16:50458033-50458055 CCCCCATCTATAGAGATGGATGG - Intergenic
1138460358 16:57144135-57144157 CCCTCACAGCCAGGGATGGGGGG + Intronic
1139326714 16:66158200-66158222 AGCTCTTCTCCAGGGATGGTAGG - Intergenic
1140976763 16:80067473-80067495 CCCCCATTTCCAGGGATGGTTGG + Intergenic
1141028554 16:80569467-80569489 GCCTCACAGCCAGGGATGGAGGG + Intergenic
1141197796 16:81874347-81874369 CCCTCATCTCCACTGTTTGAGGG + Intronic
1141442691 16:84039811-84039833 CCCTGTCCTCCAGGGATGGCTGG - Intronic
1141626997 16:85266649-85266671 CCTACCTCTCCAGGGAGGGAAGG + Intergenic
1203126078 16_KI270728v1_random:1583846-1583868 CCCTCTTCTGCAGGGATCCATGG + Intergenic
1143722591 17:8823142-8823164 CCCTGATTTCCAGGGATCCAGGG + Intronic
1144819182 17:18059464-18059486 CCCTCATTTCCTGAGCTGGAGGG - Intronic
1144846264 17:18221244-18221266 CCCCCAGCTCCAAGGATGGGTGG + Intergenic
1147048225 17:37770789-37770811 CCCTCACTTCCAGGGGTGGGTGG - Intergenic
1147989334 17:44323600-44323622 ACCACAACTCCAGGGATGGCAGG + Intronic
1148127132 17:45242660-45242682 CACCCCTCTGCAGGGATGGAGGG - Intronic
1148687181 17:49507462-49507484 CTGTCAGCTCCAGGGATGGATGG + Intronic
1148770766 17:50064654-50064676 CCCTCATCTCCAGAGCTGGGAGG + Intronic
1150438786 17:65175007-65175029 CCATAATCCCCAGGGATTGAGGG - Intronic
1150814433 17:68381700-68381722 CACTCATTCCCAGGGAAGGAGGG - Intronic
1151719538 17:75847480-75847502 CCCTCACCTGCAGGAGTGGAGGG + Exonic
1152241956 17:79165542-79165564 CCGTCACCTCCCGGGATGGCTGG - Intronic
1153643536 18:7175135-7175157 CCCTCAGCTCCTGGGATGCCCGG - Intergenic
1153942539 18:9990442-9990464 CATTCATCTCCAGGGAAGGTGGG + Intergenic
1157570146 18:48706839-48706861 CAAGCCTCTCCAGGGATGGAGGG - Intronic
1157587716 18:48815735-48815757 TCAGCATCTCCAGAGATGGAAGG - Intronic
1158591900 18:58785099-58785121 CCCTCATCTCCAGGCTTTGGAGG + Intergenic
1158782144 18:60664016-60664038 CCCTCATCTCCAGGGACACCTGG - Intergenic
1160018453 18:75162244-75162266 TCCTCATCTCAAGGGAATGATGG + Intergenic
1160787575 19:908270-908292 CACTCCTCTCCAGAAATGGAAGG + Intronic
1162745064 19:12793482-12793504 CCCAGATCTCCAGGGTTGGATGG + Intronic
1163080008 19:14932299-14932321 AACTCAGCTTCAGGGATGGACGG - Intergenic
1163286519 19:16351830-16351852 CCCTCATCTCCAGGACTGCAGGG + Intergenic
1166407116 19:42529111-42529133 GCCTCAGCTCAAGGGAGGGAGGG - Intronic
1167753451 19:51394887-51394909 CCAGAATCTCCAGGGACGGAAGG - Intergenic
926686727 2:15704025-15704047 ACCTCTGCTCCATGGATGGAGGG + Intronic
928114420 2:28536947-28536969 CCCGCCTCTCCAGGGACGGTGGG + Intronic
928115444 2:28542633-28542655 CCCTCCCTTCCAGAGATGGATGG - Intronic
928746242 2:34418978-34419000 CCCTATTCTCCAGGGAGGGGAGG + Intergenic
929268907 2:39950970-39950992 ACTCCATCTCCAGGGAGGGAGGG + Intergenic
929593705 2:43162673-43162695 ACCACATCTCCAGGGAAGGAGGG - Intergenic
930248088 2:49005253-49005275 CGGTCATCTCCAGGGAGGCAAGG - Intronic
932400134 2:71474744-71474766 TCCTCATCTACAGGGAAGGTAGG + Intronic
932622319 2:73272153-73272175 GCCTGAGCTCCAGGGATGGTGGG - Intronic
932668674 2:73718475-73718497 GCCTGCTTTCCAGGGATGGACGG - Intergenic
932820743 2:74897639-74897661 TCCTCAGCTCCAGGGAAGGTCGG + Intergenic
937000419 2:118460874-118460896 CCCCCATGTCCAGGGATGCCAGG + Intergenic
937826061 2:126369725-126369747 GCCTGATCTCCAGGGGTGGGAGG - Intergenic
939127293 2:138192856-138192878 ACCTGATCTCCAGTGCTGGATGG + Intergenic
939855940 2:147358746-147358768 CCCTGCTCTTCAGGGAAGGAAGG - Intergenic
939865165 2:147464452-147464474 TCCTCATTTCCATGGATGAAAGG - Intergenic
940802835 2:158152785-158152807 CTCTCCTCTCCAGCGATGGTGGG - Intergenic
942496937 2:176549768-176549790 CCCTTAAGTCCAGGGATGCAAGG + Intergenic
944441994 2:199752193-199752215 GCCTCAGCTCCAGGGAGGGTTGG - Intergenic
945358566 2:208867825-208867847 CCGTCATATCCAGGGTTGAATGG - Intergenic
946300727 2:218822577-218822599 TCTTAGTCTCCAGGGATGGATGG - Exonic
948279167 2:236733272-236733294 CCCTGAGCCCCAGGGATGGAAGG + Intergenic
948699068 2:239749281-239749303 CTCTCAGCTCCAGGGATGGCCGG - Intergenic
948966100 2:241381528-241381550 CCCTCTTCTCCACAGCTGGAAGG + Intronic
1168904438 20:1392376-1392398 TCCTCATCTCCAGTGAAGGGAGG + Intronic
1168970913 20:1930082-1930104 CCCCCAGCTCCAGGGGTGGCAGG + Intronic
1169244305 20:4014084-4014106 TCCTCATCTCCAGAGAGAGAAGG - Intronic
1169321414 20:4636057-4636079 CCCTCAGCGCCATGGATGGCAGG + Intergenic
1169801882 20:9518887-9518909 CCTTAAGCTCCAGGGAGGGAAGG + Intronic
1174214034 20:48902427-48902449 CCCAAATGTCCATGGATGGATGG - Intergenic
1174376305 20:50128850-50128872 CCAGCTTCTCCAGGGATGGAGGG - Intronic
1174400408 20:50272916-50272938 CTGTCATCCCCAGGGAGGGATGG + Intergenic
1174726821 20:52871427-52871449 CACTCATCTCCCAGGAGGGATGG + Intergenic
1175728261 20:61334035-61334057 CCCTCTTCTCCAGCTTTGGAGGG + Intronic
1175829253 20:61953104-61953126 CCCTCAGCTGCCAGGATGGAGGG + Intergenic
1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG + Intergenic
1176416030 21:6475235-6475257 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1178219293 21:30637818-30637840 CCCACATATCAAGGGAAGGACGG + Intergenic
1179691530 21:43083569-43083591 CACTCCTCTCCAGGGAAGGATGG - Intergenic
1179988349 21:44933046-44933068 CCCTCATCCCCAGGGAGGTGAGG + Intronic
1180971113 22:19816183-19816205 GCCTCGTCCCCAGGGAAGGAAGG - Intronic
1181989005 22:26822457-26822479 GCCTCATCTCCATGGCAGGATGG + Intergenic
1182280637 22:29216112-29216134 CCCTGGGCTCCAGGGATGGGAGG + Intronic
1182619912 22:31613338-31613360 CCCACACCTCCAGGGAGGGCAGG - Exonic
1183103491 22:35598426-35598448 CCCTCACCTGCAGGGCTGCAGGG - Intergenic
1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG + Intergenic
950135178 3:10575954-10575976 CCCTCATGTCCAGGGATGCGTGG + Intronic
950368138 3:12503819-12503841 CCAACATCTCCAGGAACGGATGG - Intronic
951841282 3:27036579-27036601 CCCTGATCTTCAGAGATGGAAGG + Intergenic
954584462 3:51721264-51721286 CCCTCCTCTCCTGGGCTGGGGGG + Intergenic
955649481 3:61178276-61178298 CCCTCATTTTCAGAGGTGGAAGG + Intronic
957038092 3:75313386-75313408 CCATCATCTCCAGACATGGAAGG - Intergenic
959565921 3:107833253-107833275 CGCTCAGCTCCAGAGCTGGATGG + Intergenic
960939361 3:122923358-122923380 CCCACACCTCCAGGGAGGCAGGG - Intronic
962305092 3:134278995-134279017 CACTCATCTGCATGGCTGGAAGG - Intergenic
962920566 3:139946655-139946677 CCCTCACCTGCTGAGATGGAGGG + Intronic
965848047 3:172987484-172987506 CCCTCACCTTCAGGTATGCATGG + Intronic
966961393 3:184943053-184943075 CCCTTCTTTCCAGGGATGCAGGG + Intronic
973021019 4:45206747-45206769 CCCCCATCTGAAGGGATGGAGGG - Intergenic
973159226 4:46994287-46994309 CCCTCCTCTCCAGAAAAGGATGG - Exonic
977648778 4:99445165-99445187 CCCTCAGCTCCATGGGTGTAGGG - Intergenic
979739615 4:124132839-124132861 CCCACATCTCTTGGGCTGGAGGG + Intergenic
981867842 4:149447011-149447033 CCATCATCTCCAGGAAAGGAAGG - Intergenic
982026034 4:151254911-151254933 CCCTCACCTCCCGGGAGGGGCGG + Intronic
985210077 4:187583321-187583343 TCCTCATCTCAAGTGACGGAAGG - Intergenic
985932961 5:3073409-3073431 CCCTAATCTCCAAGCAGGGAAGG - Intergenic
986345756 5:6833753-6833775 CCCTCATCCCCAGACCTGGATGG + Intergenic
986736591 5:10672968-10672990 CCCATATCTGCAGGGATGGCAGG - Intergenic
989075852 5:37563390-37563412 CCCTCACCTCCAGGATTGGGCGG + Intronic
989221348 5:38969001-38969023 CGCTCATCTCCCAGGCTGGAGGG + Intronic
990019382 5:51106542-51106564 CCCACAATTCTAGGGATGGATGG + Intergenic
991165541 5:63562719-63562741 CCCTCATCTCAACGAATGGGAGG - Intergenic
992397221 5:76379116-76379138 TCCTCAGCTCTTGGGATGGAAGG + Intergenic
997262423 5:132475195-132475217 CACTCAGCTCCAGGGCTGGAGGG + Intronic
997685434 5:135785310-135785332 TCGTAATCTCCAGGGAGGGAGGG + Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999135475 5:149316033-149316055 CCTGCAGCTCCAGGGATGGCAGG - Intronic
999324999 5:150638445-150638467 AATTCATCTCCAGGGATGAATGG + Intronic
1000177308 5:158770163-158770185 CCCTCAACTTAAGGGATGGTAGG - Intronic
1000242842 5:159424632-159424654 CTGTCAGCCCCAGGGATGGAGGG - Intergenic
1000247437 5:159460334-159460356 CCCTCACCACCAGGGCTGGGAGG + Intergenic
1001124526 5:169007394-169007416 CCCTGATCACCAAGGATGAAGGG + Intronic
1001205985 5:169763571-169763593 GCCACATCTCCAGGGCTGGGAGG + Intronic
1002561337 5:180084241-180084263 CCCCAATCTCCAGGGAGGGGTGG + Intergenic
1002854294 6:1023610-1023632 CCCTCATCACCTGGCATGGGTGG - Intergenic
1004820439 6:19362448-19362470 CGCTGACCTCCAGGGATGAATGG - Intergenic
1005941008 6:30559901-30559923 CCCACATGTCCACTGATGGAAGG + Intronic
1007359183 6:41342905-41342927 CCCTCATCTCAAGGGTTTTAAGG + Intronic
1011459718 6:87590279-87590301 CCCTCCTCTCCAGCCAGGGAAGG - Intronic
1013945004 6:115712021-115712043 TCCTCCTATCCAGGGATGGGAGG - Intergenic
1014957834 6:127643012-127643034 CCTTCAGCTGCAGGGATGTATGG - Intergenic
1018173909 6:161162959-161162981 CTCTCATCTCCAGGGAGGCAAGG + Intronic
1018804149 6:167245950-167245972 ACCTCATCCCCAGGGCAGGATGG - Intergenic
1022136383 7:27453297-27453319 CCCTCATCTCAAGGAAAGCACGG + Intergenic
1024527379 7:50360261-50360283 CTCTCATCCCCAGGGCTGGCAGG - Intronic
1025100304 7:56129175-56129197 CCCTGATCTCTAGGGAAGCAGGG + Intergenic
1025147654 7:56518688-56518710 CCCTGATCTCTAGGGAAGCAGGG + Intergenic
1026627606 7:72010249-72010271 CCCTTATCCCAAGGGATGAAGGG + Intronic
1027373715 7:77533490-77533512 CCCTCACCTCCCGGAAGGGACGG + Intergenic
1029324421 7:99793808-99793830 CCCACATGTCCATCGATGGATGG - Intergenic
1030668685 7:112310135-112310157 GCCTCATCTCCTGGGAAGGGAGG - Intronic
1032866433 7:135929919-135929941 AGCTCTTCTCCAGTGATGGATGG - Exonic
1034493043 7:151404538-151404560 GCCTCAGCTCCAGGGGTGGCAGG - Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035316983 7:158002583-158002605 CCCTAAGCTCCAGGGAGGGAGGG - Intronic
1035775240 8:2182595-2182617 CCGTCTTCTCCAGGAGTGGACGG + Intergenic
1035876636 8:3196776-3196798 CACTGGTCTCCAGTGATGGAAGG - Intronic
1036699327 8:11001626-11001648 CCCTCATCTCCAGGAATGGGGGG - Intronic
1037269608 8:17112120-17112142 CCCACGTGTCCAGGGAGGGAGGG - Intronic
1037917581 8:22781829-22781851 CCCTCTTCCCCAGGGAGGAAGGG - Intronic
1038418077 8:27412223-27412245 GCCTGACCTCCAGGGAGGGAAGG - Intronic
1039559461 8:38501129-38501151 CTCTCATTTCCAGGGAAGGTTGG - Intergenic
1039562862 8:38527046-38527068 CTCTGCTCTCCAGGGATGTAGGG + Intronic
1039948651 8:42151467-42151489 CCCTCAAATGCAGGGATAGATGG - Intergenic
1040387031 8:46920811-46920833 CCCTCACCAGCAGGGATGGGTGG + Intergenic
1042196240 8:66232841-66232863 CCCTCACCTCCAGGGTGGGGCGG - Intergenic
1048326295 8:133441937-133441959 CCCTCATCTCTGGGGATCCAGGG + Intergenic
1048628682 8:136216073-136216095 CTCTTATCTCCATGGATGTAGGG + Intergenic
1049575454 8:143387748-143387770 CCCACTTCTCCAGGGAAGGGTGG + Intergenic
1049766863 8:144358956-144358978 CCCTCCTCTCCAGGGAGAGGCGG - Exonic
1053479509 9:38405577-38405599 CCCTCTCCTCCAGGGACGGATGG - Intergenic
1054879854 9:70133836-70133858 CACTGTTCTCCAGGGATGGGTGG - Intronic
1056023579 9:82467132-82467154 CCCTCTGCTCAAGGAATGGAGGG - Intergenic
1057631873 9:96725827-96725849 ACCCCATCCCCAGGGATGGGCGG + Intergenic
1061872508 9:133528362-133528384 CAATCATGTCCACGGATGGACGG + Intronic
1062092031 9:134683350-134683372 CCCTCCTCCCCAGGGAGGAATGG - Intronic
1062093200 9:134689329-134689351 CCCTCCTCCCCAGGGAGGAATGG - Intronic
1062212395 9:135372105-135372127 CCCACATCTCCCGGGTGGGATGG - Intergenic
1062394013 9:136345462-136345484 CCCTCATGGCCAGGCACGGACGG - Intronic
1062403675 9:136383411-136383433 CCCTCCTCTCCATGGCTGGCTGG + Exonic
1186309709 X:8304275-8304297 CCCTCATCCCAATGGAAGGAAGG + Intergenic
1186977912 X:14928081-14928103 TCCTCATCTCAATGGATGGTAGG + Intergenic
1188684063 X:33047448-33047470 CCATCATTTGCAGGGCTGGAGGG - Intronic
1189051882 X:37654042-37654064 ATCTCATCTCCAGTGCTGGATGG + Intronic
1194852068 X:98881694-98881716 CCCTCTTCTGCAGGGTTGTAGGG - Intergenic
1195000147 X:100636091-100636113 CCGTCCTCTCCAGGTAGGGATGG + Intronic
1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG + Intronic
1195833411 X:109085652-109085674 CCTTCATCCCCTGGGATGCAAGG - Intergenic
1198018996 X:132640028-132640050 CCCTCACCTCCAGGGCTAAAAGG - Intronic
1198282320 X:135154318-135154340 CCCTGCTCTACAGGGATGGGAGG - Intergenic
1198284609 X:135177291-135177313 CCCTGCTCTACAGGGATGGGAGG - Intergenic
1198286993 X:135200752-135200774 CCCTGCTCTACAGGGATGGGAGG - Intergenic
1198288639 X:135218204-135218226 CCCTGCTCTACAGGGATGGGAGG + Intergenic
1200079926 X:153571277-153571299 CCCTCAGCTCCCAGGAAGGAAGG - Intronic
1200223254 X:154402623-154402645 CCCCCAGCCCCAGGGCTGGATGG + Exonic