ID: 1195718819

View in Genome Browser
Species Human (GRCh38)
Location X:107845868-107845890
Sequence CAGTGTAAGTATAAATATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195718814_1195718819 18 Left 1195718814 X:107845827-107845849 CCTCTCAACTAATGTACTAATGG 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1195718819 X:107845868-107845890 CAGTGTAAGTATAAATATAAGGG 0: 1
1: 0
2: 3
3: 37
4: 289
1195718813_1195718819 19 Left 1195718813 X:107845826-107845848 CCCTCTCAACTAATGTACTAATG 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1195718819 X:107845868-107845890 CAGTGTAAGTATAAATATAAGGG 0: 1
1: 0
2: 3
3: 37
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195718819 Original CRISPR CAGTGTAAGTATAAATATAA GGG Intronic
900201393 1:1408539-1408561 CTCTGTAAATATAAACATAATGG + Intergenic
904109587 1:28115172-28115194 CTGTGTAAATATTAACATAATGG - Intergenic
904705329 1:32386017-32386039 CAGTTTAAGTAAAAAAATAAGGG + Intronic
905835102 1:41112039-41112061 CAGTGAAGGTATAATTGTAAAGG - Intronic
907020478 1:51061508-51061530 CTGTGTTACTATTAATATAAAGG - Intergenic
907650842 1:56293499-56293521 CAGTGTAAATTTTGATATAATGG - Intergenic
908799024 1:67859722-67859744 CAATCTAATTATAATTATAAGGG + Intergenic
908950376 1:69554290-69554312 TAGTGAAAGCATAAATAAAAAGG + Intergenic
909042600 1:70671861-70671883 CAGTTTTATTATAAATAAAAGGG - Intergenic
909086043 1:71171489-71171511 CAGGGTAAGGATATAAATAAAGG - Intergenic
910009808 1:82447649-82447671 AAGTGTGATTATAAATACAAAGG + Intergenic
910056089 1:83034571-83034593 CAGTGCAAGTAGAAAGATAATGG + Intergenic
910752738 1:90651817-90651839 AAATGTAAGTAGCAATATAATGG + Intergenic
911057271 1:93719640-93719662 CATTGAAAGTTTAAATATAGAGG - Intronic
911452290 1:98078858-98078880 CAGTATAAGGTTAAATAAAAAGG - Intergenic
911735599 1:101333529-101333551 CAGTGTAACTGTAAAAATATAGG - Intergenic
913274396 1:117122737-117122759 CCGTGTAATTATAAAGTTAAAGG - Intergenic
913707957 1:121446939-121446961 CAGAGTAAGTATAAGTATATTGG + Intergenic
914325557 1:146612051-146612073 AAGTGTTAGTATAAATTTTAGGG - Intergenic
915375902 1:155395314-155395336 CAGAGTAAGTTTAAGTAAAATGG + Intronic
916873639 1:168944941-168944963 TAGTTTAAATTTAAATATAATGG - Intergenic
918770498 1:188552005-188552027 CAATGTAAGAATAAAGATGAGGG - Intergenic
918905674 1:190489645-190489667 GAGTGTAGATATAAATATAAAGG - Intergenic
919225527 1:194694472-194694494 CCATTTAAGTAGAAATATAAGGG + Intergenic
921707232 1:218336907-218336929 CAGTGTAAATATAACTTTACTGG - Exonic
921985167 1:221304914-221304936 CAGCTTAAATATAAATATATTGG - Intergenic
923514048 1:234679660-234679682 CATTCTAAATATAAACATAATGG + Intergenic
1063019682 10:2115061-2115083 CAGTTCAAATAAAAATATAAGGG - Intergenic
1064449887 10:15432229-15432251 CAGTGTAATAATAGAAATAAAGG + Intergenic
1064509117 10:16069918-16069940 AAGTGTAAGTAAATATAAAAAGG - Intergenic
1064805674 10:19128735-19128757 CATTAGAACTATAAATATAATGG + Intronic
1065301619 10:24327398-24327420 CCCTATAAGTATAAATTTAAGGG + Intronic
1065988015 10:30976349-30976371 CAAAGAAAGTGTAAATATAACGG + Intronic
1066978278 10:42389039-42389061 CTGTGTAAATATAGATGTAAGGG + Intergenic
1068664207 10:59655439-59655461 CAGTTTAAGGATATTTATAATGG + Intronic
1068830366 10:61487297-61487319 CAGTGTAGGTAAAACTAGAAAGG + Intergenic
1071153559 10:82664144-82664166 CAGTGTAATGATATATATTATGG - Intronic
1072050184 10:91696333-91696355 TGGTGTATGTATATATATAATGG + Intergenic
1075908039 10:126099419-126099441 CACTGTAAATATAAGTATAGTGG - Intronic
1077126680 11:942294-942316 CAGTGGAATTTTAAATAGAATGG + Intronic
1078372639 11:10762354-10762376 AAATGTAAGTGTAAAAATAAAGG + Intronic
1078976996 11:16488860-16488882 CATTCTAAGTAAAAATATCAGGG + Intronic
1079979029 11:27129462-27129484 CAGTCTAAGTTGAATTATAAAGG + Intergenic
1081338623 11:41900124-41900146 CAGTTTAACAATAAAGATAAAGG - Intergenic
1083971908 11:66082928-66082950 CAGTGAAACTATGAATATGATGG + Intronic
1085925629 11:81016774-81016796 CATTGTAAGTATACAGATATTGG + Intergenic
1086240121 11:84680347-84680369 CAGTATCAGTATGAAGATAAGGG + Intronic
1087846329 11:102977663-102977685 CAGGGTAGGTAGAAATAGAAAGG - Intergenic
1089041770 11:115458201-115458223 CAACGTAACTATAATTATAAAGG + Intronic
1092600911 12:10063312-10063334 CAGTATAATTGTAAAAATAAAGG + Intronic
1093013953 12:14137780-14137802 CAATGTTATTACAAATATAATGG - Intergenic
1094641792 12:32282950-32282972 AAGTGGAAATATGAATATAAAGG + Intronic
1094676267 12:32623169-32623191 AAGTGGAAATAAAAATATAAAGG + Intronic
1095241975 12:39871170-39871192 CAGTGAAATAATAAATAAAATGG + Intronic
1097811050 12:64019674-64019696 CTGAGTAAGTATTAATATAATGG - Intronic
1098254237 12:68600176-68600198 CAGTGTAATGAAGAATATAATGG - Intergenic
1098750743 12:74291389-74291411 CAATGTAAGAAGAAATTTAAAGG + Intergenic
1098876253 12:75869078-75869100 CAGCGTATATAAAAATATAAAGG - Intergenic
1099281506 12:80654386-80654408 CAATGTAAGTATAAAAGTTATGG + Intronic
1099356938 12:81649143-81649165 CACTGTTAGAATAAATAAAAAGG + Intronic
1099623752 12:85039287-85039309 CAGTGTAAGTATTATTACCAGGG + Intronic
1100821626 12:98437033-98437055 CAGTGGGAGTATAAATATAATGG + Intergenic
1101567529 12:105922373-105922395 AACTCTAAGTAAAAATATAATGG + Intergenic
1102730691 12:115106296-115106318 CAGTCTAAGAAGAAACATAAAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106073009 13:26431562-26431584 CAGGGTAAGCATATTTATAAAGG + Intergenic
1106602801 13:31201398-31201420 CAGTGTAATTAAAAATATTAGGG + Intronic
1106816149 13:33409449-33409471 GAGTGGAAGAATAAATAAAAGGG + Intergenic
1107704137 13:43082307-43082329 CAGTATAACTTTAAATATGATGG - Intronic
1108326452 13:49337051-49337073 CAGTGAGGGTACAAATATAAAGG + Intronic
1108402069 13:50055648-50055670 CAGTGAAAGTAAAAATGAAAGGG - Intergenic
1108434812 13:50391487-50391509 CAGTTTAAGTATAAAGACACAGG + Intronic
1109148004 13:58806782-58806804 CAGTGAAAATATACATATATTGG + Intergenic
1109531828 13:63659758-63659780 CAGGCTAAGTATAAAGATCAAGG + Intergenic
1109647271 13:65274842-65274864 CAGCGTATGTATAAACATAAAGG - Intergenic
1109994838 13:70109208-70109230 CATTCTAAGTATAGATATAAGGG - Intergenic
1111032120 13:82615291-82615313 CAGTGAAAGTACAAAAACAATGG + Intergenic
1112939738 13:104847187-104847209 CAGTATAAGTAGTAATTTAATGG - Intergenic
1114571675 14:23673591-23673613 CAGTATAAGAGTCAATATAATGG + Intergenic
1114851609 14:26389109-26389131 TAGTGCAAGTATAGATAGAAAGG + Intergenic
1114944785 14:27666506-27666528 CAGTGTAAATATAAATAAAAGGG - Intergenic
1115054951 14:29112594-29112616 AAGAGAAAGTACAAATATAAAGG - Intergenic
1115591182 14:34866794-34866816 CAGTGCTAGTAGAAATAGAATGG + Intronic
1116638674 14:47432562-47432584 AAGTGAAAATATAAATATACTGG - Intronic
1117265724 14:54084601-54084623 CAGTGCAAGTATTTATACAATGG + Intergenic
1117474385 14:56078976-56078998 CAATGTAAGTATTATTATTAAGG - Intergenic
1117863739 14:60122534-60122556 GAGTGTAATTTTAAATATGATGG - Intronic
1118544364 14:66869827-66869849 CAGAGTACTTATGAATATAATGG - Intronic
1119534144 14:75387157-75387179 CAGTGAAAGTAGAAATTTGAGGG + Intergenic
1125696291 15:41640191-41640213 CAGCGTAATTATAAATGCAAAGG + Intronic
1125807285 15:42504568-42504590 CAGTAAAAATATTAATATAATGG + Intronic
1126481391 15:49124926-49124948 CAGTGTCAGTCTAAATCTATGGG - Intronic
1129784146 15:78297368-78297390 CATTGTAAGTATTAATTTGAGGG + Intronic
1130581549 15:85141666-85141688 CAGTGTTTTTATAAATAGAAGGG - Intergenic
1131865719 15:96707205-96707227 CAGTTCAAATATAAATAGAAAGG + Intergenic
1132217361 15:100075065-100075087 CAATAGAAGTATAAATATACGGG - Intronic
1134852701 16:17494387-17494409 TAGTGTAAGCTTAAAAATAATGG - Intergenic
1135299905 16:21317246-21317268 CATACTAAGTATAAATATTATGG + Intergenic
1135576959 16:23593522-23593544 CTTTGTAAATATAAATAAAATGG + Intronic
1135903355 16:26487273-26487295 CAGTTTCAGTATATATAAAATGG - Intergenic
1139868238 16:70081076-70081098 TAGTGATACTATAAATATAAAGG - Intergenic
1140008005 16:71098896-71098918 AAGTGTTAGTATAAATTTTAGGG + Intronic
1140387095 16:74550772-74550794 TAGTGATACTATAAATATAAAGG + Intronic
1140956780 16:79873844-79873866 CAGAGGAAGTATGAATAGAAAGG - Intergenic
1144428575 17:15169618-15169640 CAGTGTATGCATCTATATAATGG - Intergenic
1146430767 17:32792127-32792149 CAATGCAAGTATAAATACAATGG + Intronic
1146914599 17:36670422-36670444 CAGTTTTCATATAAATATAATGG - Intergenic
1148574219 17:48697750-48697772 CATTGTAAGTATAGCAATAAAGG - Intergenic
1149151133 17:53565374-53565396 CAGTTTAAGAATAAATAATATGG - Intergenic
1151073864 17:71248725-71248747 CTGTGTAAGTTGAAATAGAAGGG + Intergenic
1151781331 17:76248035-76248057 CACTGAAAGTATATAGATAAGGG - Intergenic
1153120994 18:1726935-1726957 CAATGTAAGTTTAAAAAGAAGGG - Intergenic
1154301183 18:13194120-13194142 CAGCGTAAGTATAAAAACATGGG + Intergenic
1155523852 18:26696833-26696855 CAGTATTAGCATAAATAGAAAGG - Intergenic
1158032796 18:52987174-52987196 GAGTGTGAGTATAGATAGAAAGG - Intronic
1158745256 18:60192488-60192510 CAGTGTCAGTAGAAATTTTAGGG - Intergenic
1158911610 18:62068632-62068654 GAGTGTAAGTGAAAACATAAAGG - Intronic
1159300749 18:66563361-66563383 CAATGTAGATATAAATTTAATGG + Intronic
1159340841 18:67130822-67130844 CAATGTAAGTCTCAATATACAGG - Intergenic
1159469695 18:68836298-68836320 CAGTGTAACTAAAAATACAGAGG - Intronic
1159972846 18:74675166-74675188 CAGAGAAAGCATAAGTATAAAGG - Intronic
1160306329 18:77742163-77742185 CAGTAAAAGTATTAATATAATGG + Intergenic
1160469832 18:79120168-79120190 CAATGTATGTATAAAGATGATGG - Intronic
1162082590 19:8227292-8227314 CAGTGTATGTATATATATTAAGG - Intronic
1162539669 19:11287095-11287117 CAGTGAAAGAATAAATTTTAGGG - Intergenic
1162653577 19:12110789-12110811 TATTCTAAGAATAAATATAATGG - Intronic
1164167782 19:22697993-22698015 CAGTAGAAGTAAAAATATTACGG - Intergenic
1166058058 19:40305591-40305613 CAGTGAATGTTCAAATATAATGG - Intergenic
925782179 2:7391392-7391414 CAATGTGAGTATATATATAATGG - Intergenic
928789416 2:34933017-34933039 AGGTGTAAGTATAGATATCAAGG + Intergenic
928869291 2:35958007-35958029 CAGTGTAACTTCAAATATGAAGG - Intergenic
929406182 2:41644450-41644472 TACTGTAAGTATACATATATGGG + Intergenic
929937295 2:46302770-46302792 AAGCTTAAGTAAAAATATAAGGG + Intronic
930362274 2:50396672-50396694 CTGTTTAAGTATAACCATAAAGG + Intronic
930856894 2:56028567-56028589 CAGTGGATGTAAAAGTATAAGGG - Intergenic
931680557 2:64744451-64744473 CAATGTAAGAATAAAAAGAAGGG + Intronic
932937667 2:76124478-76124500 AAGTGGAAATATAAATAAAAAGG + Intergenic
933204602 2:79491204-79491226 AAGTTGAAGTATAAATAAAATGG - Intronic
933238463 2:79892262-79892284 TAGTTTAAGTATTAATTTAATGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935255349 2:101305402-101305424 TAGTCTAAGTAGAAATATAAGGG - Intronic
936571617 2:113621685-113621707 TAGTGTTTGTATTAATATAAGGG - Intergenic
937473471 2:122193419-122193441 CAGTATAATTATAAATAAAACGG - Intergenic
937579268 2:123463606-123463628 CAGTGTAAAAATAAATGTAGTGG - Intergenic
939981504 2:148787607-148787629 CAGTATAAGTGAAAATTTAAGGG + Intergenic
940393357 2:153159128-153159150 CAGTTTTAGTATAAAGAAAATGG - Intergenic
941164623 2:162072115-162072137 TTTTGTAAATATAAATATAAAGG - Intronic
941668373 2:168263855-168263877 ATGTGTATGTATATATATAAAGG - Intergenic
942701936 2:178721280-178721302 CAGTTTAAATATAAATTTATGGG - Intronic
942929260 2:181470135-181470157 GAAAGTAAGTATAACTATAATGG + Intronic
943422009 2:187677147-187677169 CAGTGAAAGTAGAAATCAAAAGG + Intergenic
944343565 2:198633299-198633321 AAGGGTGCGTATAAATATAAGGG + Intergenic
944926606 2:204471748-204471770 CAGAGTTAGTATAAACAGAAAGG + Intergenic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
947283718 2:228485530-228485552 CCGTTTAAGGATAAATATACAGG + Intergenic
948079440 2:235193484-235193506 TAGAGTAAGTACAAATATATTGG - Intergenic
948623915 2:239255513-239255535 CTGTGTAAGAATAAAGACAAAGG - Intronic
1169471468 20:5889300-5889322 CAGAGTATGTGTAAATATAGAGG - Intergenic
1171314130 20:24172297-24172319 TAGTGTAATTATTAATATTAGGG + Intergenic
1172816726 20:37693110-37693132 AAATATAATTATAAATATAAAGG + Intergenic
1173153088 20:40584447-40584469 GAGTGAAAGAATAAATAAAATGG - Intergenic
1174941099 20:54929093-54929115 CAGTAAATATATAAATATAATGG - Intergenic
1175406252 20:58731905-58731927 CTGTGTTAGTATAAAGATAATGG + Intergenic
1178494806 21:33077684-33077706 CAGTGTAGGAAAAAATAAAATGG + Intergenic
1180849336 22:19005921-19005943 CAGTGGAAGAGTAAATATGAAGG + Intergenic
1185428580 22:50789205-50789227 TAGTGTTTGTATTAATATAAGGG + Intergenic
949227762 3:1714249-1714271 AAAAGTAAATATAAATATAAAGG + Intergenic
952019499 3:29000251-29000273 CAATGTAACTTTTAATATAATGG + Intergenic
953113236 3:39964884-39964906 CAATGGAAGTATAAATATATTGG + Intronic
953972013 3:47355358-47355380 CAGTGAGAGTAAAAAGATAAGGG + Intergenic
955389567 3:58511097-58511119 CATTGTATGTATAAATGCAAGGG - Intronic
955786695 3:62548415-62548437 CAGTGTAAATAATCATATAATGG - Intronic
956020773 3:64931245-64931267 CAATGTAGCTATAAAGATAAAGG - Intergenic
956393189 3:68796405-68796427 CAGTGCAACTATAAATATACTGG + Intronic
957024935 3:75170490-75170512 CACTGTAAGCAGAAATGTAATGG - Intergenic
957028336 3:75210816-75210838 TTGTATAAGTAAAAATATAAAGG - Intergenic
957149763 3:76470886-76470908 AAGTGTATGTATAAATAAATGGG - Intronic
957837364 3:85614440-85614462 CAGTTTAAAAATTAATATAATGG + Intronic
958021922 3:88008047-88008069 GAGTGTAACTGTAAATATTAAGG + Intergenic
959846214 3:111036437-111036459 CAGTGCCAGTATAAATACCATGG + Intergenic
960359347 3:116692149-116692171 CTCTGGAAATATAAATATAATGG - Intronic
962120985 3:132559622-132559644 CAGTGTAAAAATTAACATAATGG + Intronic
962129014 3:132652560-132652582 CAGTGTAAGCAAAAAAAAAATGG - Intronic
962589693 3:136876545-136876567 CAGTGTATATATAAATCTAAAGG + Intronic
963324547 3:143847629-143847651 CACTGTTCGTATAAATAAAAAGG + Intronic
963421734 3:145069707-145069729 CACTGTAAGAATAAGTCTAAAGG - Intergenic
963512338 3:146263236-146263258 CAGTTTAAATTTAAATATACAGG - Intergenic
963586849 3:147202681-147202703 CAGCCTAAATATAAGTATAAAGG - Intergenic
963682847 3:148402145-148402167 AATTGGAATTATAAATATAAAGG + Intergenic
963804122 3:149706297-149706319 CAGTGTTAGTAGAAATACTAAGG - Intronic
964305713 3:155337327-155337349 CACAGTAAATATAAATATAGTGG - Intergenic
964796797 3:160507002-160507024 CTGGATAAGCATAAATATAAAGG - Intronic
964959051 3:162400833-162400855 AAGTGAAATTATAAATATACGGG - Intergenic
965655581 3:170980413-170980435 CACTGTAAATATAAACATATAGG - Intergenic
966058062 3:175720344-175720366 CAGTGAAATTAAAAATACAATGG + Intronic
966378440 3:179320856-179320878 CAGTATAGGTATAAAAATAACGG + Intergenic
966798189 3:183736324-183736346 CAGTGGAGGAATAAATACAAGGG + Intronic
967431222 3:189387665-189387687 GAGTGTAAGAATAAATCAAATGG - Intergenic
968319534 3:197752533-197752555 CAGTGTATGTATAAAAATAAAGG - Intronic
969904364 4:10379669-10379691 GAGTGTATATATAAATATATGGG - Intergenic
971131638 4:23817576-23817598 CCCTGTGAGTAAAAATATAAGGG + Intronic
972086746 4:35226947-35226969 CAGTGTGAGTATGCATATGATGG + Intergenic
972863927 4:43206728-43206750 CATTGAAAGTATAAATATTAAGG + Intergenic
973947244 4:55970893-55970915 CAGTGTATCTATAACTATACTGG - Intronic
974776180 4:66484866-66484888 CAGTTTCACTATAAAGATAAGGG - Intergenic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
976936756 4:90645445-90645467 GACTATAAGTATAGATATAAAGG - Intronic
976953639 4:90866546-90866568 AAATGTAAGTCTAAATTTAATGG - Intronic
977310167 4:95376159-95376181 ATGTGTAAGTATATATAGAAAGG - Intronic
977536778 4:98262375-98262397 CAGATTAACTATAAATACAAAGG - Intronic
978136068 4:105262273-105262295 CATTGTAAGTATATATATTTCGG + Intronic
979565284 4:122147800-122147822 CAGAGAAAGTATAAATTGAAGGG + Intergenic
979759862 4:124388956-124388978 CAGTTTAAGAATAAATTAAATGG + Intergenic
980265463 4:130508613-130508635 CAATCTTAGTAAAAATATAAAGG + Intergenic
980328219 4:131376175-131376197 AAGTGAAAATATAAATATTAAGG + Intergenic
980840373 4:138252425-138252447 CAGTGTAATAAAAAATAAAAAGG + Intergenic
980934249 4:139211321-139211343 CAATGTCAGTACAAATAAAATGG - Intergenic
981189424 4:141843471-141843493 CTGTGTAAGAATAAACAAAAAGG + Intergenic
981963182 4:150566706-150566728 CAGTCAAAGTATACAGATAAAGG - Intronic
982010582 4:151102107-151102129 GAATGTCAGGATAAATATAATGG - Intronic
982284334 4:153718922-153718944 CAGTGTAAGTAGCAAGAAAAGGG - Intronic
983199023 4:164840827-164840849 CACAGTAAGTGTAAAAATAAGGG + Intergenic
983217439 4:165015379-165015401 CAGTGTACGTATTAACGTAAAGG + Intergenic
986401130 5:7382268-7382290 CAGTGTAAGGATTAATTTAATGG - Intergenic
988188235 5:27896185-27896207 AGGTGTAAATATAAAAATAATGG - Intergenic
988897030 5:35687440-35687462 AAGTGCAAGAAGAAATATAATGG - Intronic
989961442 5:50420358-50420380 CATTGTAAGACTAAATATCAAGG - Intronic
989970134 5:50513753-50513775 CAGAGTAAGTATAAGTACATTGG - Intergenic
989994304 5:50809538-50809560 CTGTTTAAGTATTAATATAAGGG - Intronic
992498051 5:77312442-77312464 CATTTTGAGTATAAATATGATGG + Intronic
993088434 5:83393698-83393720 TACTGTAAGGTTAAATATAAAGG + Intergenic
994089271 5:95794782-95794804 CAGTGTTGGTATACATACAAGGG - Exonic
996975017 5:129422011-129422033 CAGGTTAAGTGTAAATATAATGG + Intergenic
998238833 5:140424155-140424177 CAGTGGAAGTATATATACCAGGG - Intronic
998772802 5:145565348-145565370 CAATGTCAGAATTAATATAATGG - Intronic
999608938 5:153348642-153348664 CAGTGCAGGAATAAATATGAGGG - Intergenic
1001521011 5:172393048-172393070 AAGTGTATGTGGAAATATAAAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004935201 6:20500728-20500750 CAGAGTAAGTAAAATTATCAGGG + Intergenic
1005081741 6:21963027-21963049 CAGAGTAAGTAGAAACTTAAAGG + Intergenic
1005510291 6:26506431-26506453 CTGTGAAATAATAAATATAATGG - Intronic
1005757484 6:28938140-28938162 GAGTGTAGGCATAAATATAAAGG - Intergenic
1006037298 6:31223628-31223650 CAGAATAAATATATATATAAAGG - Intergenic
1006651339 6:35554361-35554383 CAGTGTCCGTTTAAATATAGAGG + Intergenic
1007566051 6:42851208-42851230 CATTTTAAGTAAAAAGATAAAGG - Intronic
1008485667 6:52032438-52032460 CATTCTACGTATAAAAATAATGG - Intronic
1008523168 6:52381778-52381800 CTGTGTATGCATAAAGATAAAGG - Intronic
1008955473 6:57211728-57211750 CACTGTATGTGTAACTATAAAGG - Intronic
1009556426 6:65175655-65175677 AAGTGTAAGTTTATATATGAAGG + Intronic
1009834631 6:68983710-68983732 CAATGTAAATATAAATAGACAGG + Intronic
1010360745 6:74990620-74990642 CATTGTAAATATTCATATAATGG + Intergenic
1010671531 6:78692393-78692415 CAGTATAAAAATAACTATAATGG + Intergenic
1011103272 6:83748332-83748354 AAGTGTAAGAATGATTATAAGGG + Intergenic
1011409035 6:87046826-87046848 CAGTATAAGTTTTGATATAAAGG - Intergenic
1011910452 6:92430135-92430157 TAATGTAATTATCAATATAATGG - Intergenic
1011986951 6:93459048-93459070 CAGTGTTAATATAAAAATACAGG - Intergenic
1012050536 6:94337069-94337091 CAGTGTAAATATATATATATAGG + Intergenic
1012752411 6:103180780-103180802 CAGAATAAGTATAAATATATTGG - Intergenic
1013253629 6:108360663-108360685 CAGAGAAAGTGAAAATATAAGGG + Intronic
1013621207 6:111891270-111891292 CTGTGTGTTTATAAATATAATGG + Intergenic
1017444086 6:154491762-154491784 CATTGTTAGTATTAAAATAAGGG + Intronic
1018267708 6:162042822-162042844 CAGTATAAGTTTTAATAAAATGG + Intronic
1018332953 6:162751994-162752016 CCATGTAAGTATGAATAAAATGG - Intronic
1018879035 6:167857038-167857060 CAGTGTGAGTATAAATAACGAGG - Intronic
1020730651 7:11874848-11874870 CAATGTAAGTTCAAATATTAAGG - Intergenic
1021006830 7:15407272-15407294 TAGTGTTTATATAAATATAATGG - Intronic
1022198360 7:28092152-28092174 CACTGTAATTACATATATAAAGG + Intronic
1022584800 7:31598121-31598143 CAGTGTAAGTGTAAAAAGTAAGG + Intronic
1022915734 7:34949918-34949940 CAGTGTATGGCTTAATATAATGG - Intronic
1023264011 7:38386721-38386743 AAGTGTAAATTTATATATAATGG + Intronic
1024376005 7:48638845-48638867 ATGTGAAAGTATTAATATAAAGG + Intronic
1024485785 7:49917865-49917887 CAATGTAAATATAAAAGTAAAGG - Exonic
1024864790 7:53892765-53892787 CAGTGAAAATATAAAAATAAAGG - Intergenic
1025033366 7:55574906-55574928 GAGTGTAATTAAAAATACAAGGG + Intergenic
1025771105 7:64508320-64508342 CAGCATAAATATAAATATTATGG - Intergenic
1026587948 7:71672141-71672163 CAAAGTAAGATTAAATATAAAGG + Intronic
1028636145 7:92991626-92991648 CAGTTTAAGTATTAATATATTGG + Intergenic
1030552141 7:110975075-110975097 CAGTGTAACTATGAATAGATAGG - Intronic
1030767107 7:113423643-113423665 CATTGTAATGATAAAGATAAGGG - Intergenic
1030780152 7:113590928-113590950 AAATGTAAGTGTAAATGTAAAGG + Intergenic
1030996014 7:116359173-116359195 CAGTGTATCTATACATATATGGG + Intronic
1031763932 7:125751179-125751201 AAGTATAAATATAAACATAAAGG - Intergenic
1032938260 7:136758858-136758880 CAGTGGATGTAAAAATAAAAGGG + Intergenic
1034057607 7:148052162-148052184 CCTTGTAAGCATAAATACAAAGG + Intronic
1036051325 8:5201800-5201822 AAGTGTAAATATAAATATATAGG - Intergenic
1036076057 8:5501700-5501722 AAGTGTAAGATTAAATATAATGG + Intergenic
1037226934 8:16603499-16603521 TTGTTTAAGGATAAATATAAGGG - Intergenic
1037293488 8:17375830-17375852 CAGAGTAACTATAAATAGCATGG + Intronic
1038114342 8:24536129-24536151 CATTGTAAGCATCAATATTAAGG - Intergenic
1038911790 8:31972982-31973004 CACTGTATGTATAAATTTATGGG + Intronic
1039241902 8:35566513-35566535 AAGTGTAAGTACTAAAATAAAGG + Intronic
1042749569 8:72143301-72143323 ATTTCTAAGTATAAATATAAGGG + Intergenic
1043085393 8:75825893-75825915 CAGTGTAATGGTAAATATGAGGG + Intergenic
1043830933 8:84988110-84988132 CAGTGAAAGTCAAAAAATAATGG - Intergenic
1044088287 8:87968987-87969009 ATGTGTATATATAAATATAATGG - Intergenic
1044277360 8:90317664-90317686 TAGTGTAAGTATACATACATAGG + Intergenic
1044382316 8:91548890-91548912 CAGTGCAAATACAAATAGAAAGG + Intergenic
1044583806 8:93850210-93850232 CAGTCTGAGTATAAAGATACAGG - Intergenic
1044859024 8:96504125-96504147 ATGTGAAAGTATTAATATAAAGG + Intronic
1048692640 8:136985147-136985169 AAGTGTAATTATAAATAATACGG + Intergenic
1048707899 8:137174936-137174958 AAGTGTAACAATAAATATAAAGG + Intergenic
1048723540 8:137356505-137356527 AAATGTAATTATAAATGTAATGG + Intergenic
1050016617 9:1240754-1240776 CAGTGTAGCTACAAATATAATGG - Intergenic
1050042174 9:1507582-1507604 TAGTGAAAGTATAAAGAGAAGGG + Intergenic
1050965250 9:11792902-11792924 TATTGAAAGTAAAAATATAAAGG + Intergenic
1051189432 9:14495641-14495663 CAGTGTAATTAAAAATAAGAAGG + Intergenic
1051346984 9:16161004-16161026 CAGTGTAAGAGTAAAGATGATGG - Intergenic
1051832502 9:21296044-21296066 CAGTTTTTTTATAAATATAATGG - Intergenic
1051914765 9:22195267-22195289 CAGGGAAAGTAAAAAGATAAAGG - Intergenic
1052572455 9:30243925-30243947 CATTGTAAGTATAAAATAAAAGG + Intergenic
1052619912 9:30893767-30893789 CAGTGTAAATAAAGATAGAAAGG - Intergenic
1055034989 9:71809135-71809157 CAGTGTATGTATTTTTATAAAGG + Intronic
1057122088 9:92585775-92585797 CAGTGAAAGTATCAATATTATGG + Intronic
1060443270 9:123661775-123661797 GAGTGAAAATATTAATATAATGG + Intronic
1061280100 9:129593051-129593073 CTGTGTAAGTATAAATGGAAAGG + Intergenic
1185969956 X:4651484-4651506 CAGGGTAATTAAAAATAAAAAGG + Intergenic
1186677893 X:11839026-11839048 CAGTTTAAGTTTAAATTTTAAGG + Intergenic
1186985378 X:15008314-15008336 TAGTGTTAGTATAAATAAATGGG - Intergenic
1187025493 X:15431350-15431372 CAGTGAAATTATAGATGTAAAGG + Intronic
1188310902 X:28615473-28615495 CAGTTTAAAAATAAGTATAATGG + Intronic
1192031529 X:67518245-67518267 CATTATAAATATAAATATAATGG + Intergenic
1193365853 X:80631945-80631967 CAGTGTATGGAAAAATATAGAGG + Intergenic
1193648661 X:84101864-84101886 CAGTGTAAATATTTATATTAGGG + Intronic
1195718819 X:107845868-107845890 CAGTGTAAGTATAAATATAAGGG + Intronic
1198113821 X:133525702-133525724 CAATGTATGTATATATAAAAAGG - Intergenic
1198193438 X:134334696-134334718 CAGAGTCAGTATCAATATCACGG + Intergenic
1198717162 X:139569894-139569916 CATTGTAAATTAAAATATAAAGG + Intergenic
1198719346 X:139598988-139599010 CATTGCCACTATAAATATAAGGG + Intronic
1202343718 Y:23897612-23897634 CAGTTTAAGTATAGAAATAAAGG - Intergenic
1202527050 Y:25772473-25772495 CAGTTTAAGTATAGAAATAAAGG + Intergenic