ID: 1195721359

View in Genome Browser
Species Human (GRCh38)
Location X:107872043-107872065
Sequence TAGATGAGCCTCTTCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 11, 2: 38, 3: 64, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195721359_1195721362 -5 Left 1195721359 X:107872043-107872065 CCTCCTCTGAAGAGGCTCATCTA 0: 1
1: 11
2: 38
3: 64
4: 250
Right 1195721362 X:107872061-107872083 ATCTAACTGCTGGTGTAATATGG 0: 1
1: 0
2: 0
3: 24
4: 107
1195721359_1195721363 6 Left 1195721359 X:107872043-107872065 CCTCCTCTGAAGAGGCTCATCTA 0: 1
1: 11
2: 38
3: 64
4: 250
Right 1195721363 X:107872072-107872094 GGTGTAATATGGACGATGACTGG 0: 1
1: 0
2: 0
3: 3
4: 35
1195721359_1195721364 30 Left 1195721359 X:107872043-107872065 CCTCCTCTGAAGAGGCTCATCTA 0: 1
1: 11
2: 38
3: 64
4: 250
Right 1195721364 X:107872096-107872118 CTTAGCTACTTCCTGTTTACAGG 0: 1
1: 0
2: 13
3: 60
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195721359 Original CRISPR TAGATGAGCCTCTTCAGAGG AGG (reversed) Intronic
902093646 1:13924602-13924624 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
904066310 1:27754414-27754436 TAGCAGAGCCTCTTAAGAAGGGG - Intronic
907556419 1:55348454-55348476 GAGATGAGCCCCCTCAGAGATGG + Intergenic
907822847 1:57988075-57988097 TAGATGAGTCTCTTCTGGGTGGG - Intronic
908454315 1:64287527-64287549 TAGATGAGCTTTTGGAGAGGAGG - Intergenic
908892188 1:68860434-68860456 TAGATGTACCTCTTCAGAGACGG - Intergenic
909669270 1:78169459-78169481 TCAAAGAGCCTCTTCAGATGTGG - Intergenic
910158204 1:84244445-84244467 TAGATGAGCCTCTGCTGTTGTGG - Intergenic
912041503 1:105396997-105397019 TAAATGTGCTTCTTCAGAGGGGG - Intergenic
912079197 1:105913830-105913852 TAGATGCGCCTCTTCAGAGTGGG + Intergenic
914977363 1:152378644-152378666 TAGATGTATCTCTTCAGAGGGGG - Intergenic
916435481 1:164774036-164774058 TAGATGAGGAACTTCAGAGGGGG + Intronic
917076774 1:171214169-171214191 TAGATGTACTTCTTTAGAGGGGG - Intergenic
918229235 1:182513163-182513185 TAGATGTGCCTCTTCAGAGGGGG - Intronic
919280260 1:195481608-195481630 TAGATGTACATCTTTAGAGGGGG - Intergenic
919539209 1:198827953-198827975 TAGATGTACCTCTCCAGAGTGGG - Intergenic
920568582 1:206998030-206998052 AAAAAGAGCTTCTTCAGAGGTGG - Intergenic
921343694 1:214159811-214159833 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
922655128 1:227375387-227375409 TAGAGAGGACTCTTCAGAGGAGG - Intergenic
922868848 1:228883875-228883897 TAGATGTACCTCTTCAGAGGGGG + Intergenic
923469645 1:234279227-234279249 CTGATGAGCCTCTCCAAAGGGGG + Intronic
924522125 1:244814581-244814603 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1063221620 10:3974373-3974395 TTGATTAGCCTTTTCAAAGGAGG - Intergenic
1064441069 10:15354167-15354189 TCCAGGAGCCACTTCAGAGGTGG - Intronic
1065450504 10:25851706-25851728 TGGATAAGCCTTTTCAAAGGAGG + Intergenic
1067801895 10:49365161-49365183 TAGAGGGGGCTCTTCAGTGGTGG - Exonic
1067841357 10:49682012-49682034 TAGGTGTGGCTCATCAGAGGGGG - Intronic
1068138418 10:52974103-52974125 TAGATGTACCTCTTCAGATGGGG - Intergenic
1068303934 10:55179279-55179301 TAGATGCACCTCTTCAGAGGGGG + Intronic
1068310323 10:55266401-55266423 TAGATGTACCTCTTCAGAGGGGG + Intronic
1069156592 10:65037570-65037592 TTAATGTACCTCTTCAGAGGGGG + Intergenic
1070407461 10:76109881-76109903 TAGATGAGCCTGTACAGAGATGG - Intronic
1070676520 10:78415499-78415521 AAGAGGACCCTCTGCAGAGGAGG + Intergenic
1070741188 10:78904294-78904316 TGGTGGAGCCTCCTCAGAGGTGG - Intergenic
1070792795 10:79199665-79199687 TAGATGAGACTCTCCAGAAGGGG + Intronic
1070855317 10:79603808-79603830 TAGATGTGCCTCTTCAGAGGAGG - Intergenic
1071267835 10:83980068-83980090 TAAATGATCCTATTCAGAGCTGG - Intergenic
1071834192 10:89403285-89403307 TAGATGAGCCACCTCAAATGTGG - Exonic
1073289356 10:102405703-102405725 TAGCTGTGCCTCCTCAGAGCAGG + Intronic
1075265309 10:120995998-120996020 GAGATATACCTCTTCAGAGGGGG + Intergenic
1076393408 10:130120707-130120729 GTGATGAGCCTCTCCAAAGGAGG - Intergenic
1076551395 10:131280223-131280245 CTGATGAGCCTCTCCAAAGGAGG + Intronic
1076551436 10:131280495-131280517 CTGATGAGCCTCTCCAAAGGAGG + Intronic
1076595041 10:131620103-131620125 TAGGTGAGAGTATTCAGAGGTGG - Intergenic
1077712904 11:4553982-4554004 TAGATGTGCCTCTTCAGAGGGGG + Intergenic
1079862978 11:25696834-25696856 CAGATTAGCCTCTCCAGAGGAGG + Intergenic
1081179430 11:39968144-39968166 TAGATGTGCCTCTTCAGAGGGGG + Intergenic
1081319785 11:41677387-41677409 TAGATTAACTTCTTTAGAGGGGG + Intergenic
1082747746 11:56984664-56984686 TAGATGTACTTCTTTAGAGGGGG - Intergenic
1082748746 11:56995896-56995918 TAGATGTGCCTACTCAGAGGGGG - Intergenic
1084875080 11:72125103-72125125 TAGTTGTACCTCTTCAGAGGGGG - Intronic
1085309968 11:75510420-75510442 ATGAGGAGCCTCTTCAGAGCTGG - Intronic
1086002175 11:81996915-81996937 TAGATGTGCCTCTTCAGTGGGGG - Intergenic
1086469053 11:87086915-87086937 TAGAGGTACCTCTTCAGAAGGGG - Intronic
1086782996 11:90930574-90930596 TAGATGTGCCTCTTCAGAGTGGG + Intergenic
1087047374 11:93853341-93853363 CTGATTAGCCTCTTCAAAGGAGG + Intergenic
1087396688 11:97609531-97609553 TAGATGTGTCTCTTCAGAGGGGG - Intergenic
1088068341 11:105749411-105749433 TAGAGGAACTTCTTAAGAGGTGG + Intronic
1089122527 11:116147550-116147572 TAGATGTACCTCTTCAGAGGGGG + Intergenic
1092515059 12:9202654-9202676 GATCTCAGCCTCTTCAGAGGTGG - Exonic
1092569912 12:9710418-9710440 TAGATACACCTCTTCAGAGAGGG + Intergenic
1093369755 12:18353106-18353128 AAGATGTGCCTCTTCAGAGCAGG - Intronic
1095882381 12:47151813-47151835 TAGATAACCCTCTTCAGTGTGGG - Intronic
1096803455 12:54126591-54126613 TAGATGAGCCTGTCCGGAGCAGG + Intergenic
1097141681 12:56908020-56908042 TAGATGTACCTTTTCAGAGGGGG + Intergenic
1100897476 12:99200192-99200214 TAGTTCAGTCTCTTCAGAGAAGG + Intronic
1101216747 12:102593276-102593298 TAGATGTGCCTCTTCAGAGGGGG - Intergenic
1101455680 12:104827835-104827857 AAGATATACCTCTTCAGAGGGGG + Intronic
1103060677 12:117855944-117855966 TAGATGAGTCCCTGCAGAGTGGG - Intronic
1103228052 12:119304941-119304963 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1104298241 12:127538688-127538710 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1104321601 12:127756662-127756684 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1105425241 13:20288903-20288925 TAGGTGTACCTCTTCAGAGGGGG + Intergenic
1105825152 13:24115800-24115822 TAGAAGAGCCACTTCATGGGTGG + Intronic
1108204280 13:48072326-48072348 TAGATGTACTTCTTTAGAGGAGG + Intronic
1108847127 13:54692065-54692087 AAGATGTACCTCTTCAGAGGGGG - Intergenic
1109377976 13:61523190-61523212 TAGATGTGCATCTTCAGAGGGGG - Intergenic
1109458596 13:62625858-62625880 TACATGTGCCTCTTCAGAGGGGG - Intergenic
1111028615 13:82567681-82567703 TAGATGTACCTCTTGAGAGGAGG - Intergenic
1111292675 13:86188345-86188367 TTGATGTACCTCTTCAGAGGGGG + Intergenic
1111484067 13:88872032-88872054 CTGATTAGCCTCTTCAAAGGAGG + Intergenic
1112761934 13:102701280-102701302 TAGATGCGCCTCTTCAGCTCTGG + Intergenic
1113048274 13:106180459-106180481 TAGATGAGCCTTCTCTGGGGTGG - Intergenic
1113888375 13:113723580-113723602 CTGATGAGTCTCTCCAGAGGAGG + Intronic
1114640701 14:24218148-24218170 TAGATGAGCCTCTGCTGTTGTGG + Exonic
1117366227 14:55031252-55031274 TAGATTAGCCCCTTCAGTGATGG + Intronic
1118522156 14:66596975-66596997 CAGATGTACCTCTTCAGAGCAGG - Intronic
1118535427 14:66758341-66758363 TAGAGGTACCTTTTCAGAGGGGG - Intronic
1118947372 14:70399665-70399687 TAGATGTTCCTCTTCAGAGGGGG - Intronic
1119137961 14:72238124-72238146 GAGAAGAGCCTCCTCAGAGACGG - Intronic
1119474419 14:74918871-74918893 TAGATGGGGCTTTTGAGAGGGGG - Intronic
1120442520 14:84558450-84558472 TAGATGTAACTCTTCAGAGGCGG - Intergenic
1122434517 14:101685358-101685380 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1123579463 15:21703435-21703457 GAGATGAGGCTCTTGAGAGGCGG - Intergenic
1123616090 15:22145946-22145968 GAGATGAGGCTCTTGAGAGGCGG - Intergenic
1126215078 15:46145761-46145783 TAGATGAACCTCCTCAGAGGTGG + Intergenic
1127200725 15:56647037-56647059 TACAAGAGCCTCTTCAGGGAAGG + Intronic
1128289206 15:66463943-66463965 CTGATTAGCCTCTCCAGAGGAGG + Intronic
1129177650 15:73851783-73851805 AAGGTGAGCCTCTTCACAGAGGG - Intergenic
1130108917 15:80949191-80949213 TATCTGTGCCTCTTCAGTGGGGG + Exonic
1130692590 15:86096827-86096849 CAGATCAGCCACTTCAGAGGAGG - Intergenic
1131695794 15:94876323-94876345 TAGATGTACTTCTTCAGAAGGGG - Intergenic
1202988333 15_KI270727v1_random:437680-437702 GAGATGAGGCTCTTGAGAGGCGG - Intergenic
1135207894 16:20498764-20498786 TAGATGTACGTCTTCAGAGGGGG + Intergenic
1135211005 16:20524936-20524958 TAGATGTACGTCTTCAGAGGGGG - Intergenic
1135831322 16:25776364-25776386 CTGATGAGCCTCTCCAAAGGAGG - Intronic
1135882739 16:26274786-26274808 TATATGAGCTTCTTCAGGGCTGG + Intergenic
1135971340 16:27074111-27074133 AAGATGAGCCCCTTCCCAGGTGG - Intergenic
1136045365 16:27610850-27610872 CTGATGAGCCTCTCCAAAGGAGG - Intronic
1137490165 16:48925807-48925829 TAGAGGAGGCTTTACAGAGGAGG + Intergenic
1141837430 16:86551431-86551453 TTGATGTGCTTCATCAGAGGAGG - Intronic
1141916477 16:87100710-87100732 TAAACAAGCCTCTGCAGAGGTGG + Intronic
1143533740 17:7523180-7523202 TAGATGGACTTCTTTAGAGGCGG - Intergenic
1144305471 17:13966004-13966026 TAGATGTGCCTCTTCAGAGCGGG - Intergenic
1145978595 17:28998328-28998350 GAGAAGAGCCTGTTGAGAGGGGG + Intronic
1146885800 17:36469973-36469995 TAGATGTGCATCTTCAGAGGGGG - Intergenic
1147921572 17:43920519-43920541 TAGATATACCTGTTCAGAGGTGG + Intergenic
1149624150 17:58067774-58067796 GAGATGAGCATCTTAAGAGTGGG - Intergenic
1152022248 17:77786280-77786302 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1152771954 17:82175506-82175528 CTGATGAGCCTCTCCAAAGGAGG - Intronic
1153341945 18:3984513-3984535 TACATCAGTCTCATCAGAGGAGG - Intronic
1153428114 18:4988206-4988228 TAGTTGTACCTCTTCAGGGGGGG - Intergenic
1155839136 18:30626001-30626023 TAGATGTGCCTCTTCAGAGGAGG - Intergenic
1156039737 18:32807090-32807112 TCCATGAACCTCTTCACAGGAGG + Intergenic
1156129491 18:33953052-33953074 TGGATGAGCCTCTTAAGTGCTGG + Intronic
1156698404 18:39795476-39795498 TAGATGAACTTCTTTAGAGGGGG - Intergenic
1157101784 18:44737198-44737220 TAGATGTGAGTCTTCACAGGAGG - Intronic
1161650066 19:5478813-5478835 TCGAAGAGCCTCTACTGAGGAGG + Intergenic
1165680081 19:37766684-37766706 TATATAAAGCTCTTCAGAGGTGG + Intronic
1166247549 19:41539796-41539818 TAGATGTACCTCTTCAGAGGGGG + Intergenic
1167484933 19:49757183-49757205 TACATGGGCCTCTTCATAGGTGG - Intronic
925151265 2:1617107-1617129 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
925922401 2:8646590-8646612 TAGATGTACCTCTTCAGAGCAGG + Intergenic
926679013 2:15649931-15649953 AAGATGAGCCTCTCCAGATCAGG - Intergenic
927744053 2:25599750-25599772 TAAATGATGCTCTTCAAAGGAGG + Intronic
928677750 2:33666429-33666451 TAGATGTACCTCTTCAGAGGAGG + Intergenic
928833520 2:35517479-35517501 TAGATGTGCTTCTTTAGAGGGGG - Intergenic
931541498 2:63334538-63334560 TTGATTAGCCTCTCCAAAGGAGG + Intronic
933130830 2:78672778-78672800 TAGATGTACTTCTTTAGAGGGGG - Intergenic
933140971 2:78792612-78792634 TAGATGTACCTCTTCAGAGGGGG - Intergenic
933920829 2:87043070-87043092 TAGATATACCTCTTCAGAGCGGG + Intergenic
933930796 2:87150716-87150738 TAGATATACCTCTTCAGAGCGGG - Intergenic
934002169 2:87726829-87726851 TAGATATACCTCTTCAGAGCGGG - Intergenic
934932357 2:98436860-98436882 TAGATGTACTTCTTTAGAGGGGG + Intergenic
936362325 2:111814726-111814748 TAGATATACCTCTTCAGAGCGGG + Intronic
936840149 2:116758646-116758668 TAGATGTACTTCTTTAGAGGGGG + Intergenic
937538766 2:122923736-122923758 TAGATGTGCCTCTTCAGAGGGGG - Intergenic
940422972 2:153500082-153500104 TAGATGTACCTCTTCACATGAGG - Intergenic
942097478 2:172547548-172547570 TAGATGTACCTCCTCAGAGAGGG + Intergenic
943420124 2:187659167-187659189 TAGATGCACTTCTTTAGAGGGGG + Intergenic
943459963 2:188160389-188160411 TAGCTGAGCCTCATCAATGGTGG - Intergenic
945370146 2:209006265-209006287 TAGGTGTACCTCTTCAGAGGGGG + Intergenic
945561648 2:211347482-211347504 TAGATGTACTTCTTCAGAGAGGG - Intergenic
948955394 2:241286416-241286438 CTGATGAGCCTCTCCAAAGGAGG - Intronic
949028848 2:241778902-241778924 CTGATGAGCCTCTCCAAAGGAGG + Intronic
949030294 2:241792895-241792917 CTGATGAGCCTCTCCAAAGGAGG - Intronic
949060789 2:241955981-241956003 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
949074437 2:242045985-242046007 TAGAAGAGCCTCTGGAGAGCAGG + Intergenic
1170222328 20:13953493-13953515 TAGATGTACTTCTGCAGAGGGGG + Intronic
1171380155 20:24728667-24728689 CTGATTAGCCTCTTCAAAGGAGG + Intergenic
1175064937 20:56276714-56276736 TAGATGTACCTCTTTAGAAGGGG + Intergenic
1175694665 20:61092698-61092720 TCTCTGAGCCTCTTCAGAGAAGG + Intergenic
1175832650 20:61974670-61974692 TAGCTGAGCCCCATCAGAGCCGG - Intronic
1178145375 21:29734124-29734146 TAAATAAGCCTCTTCAGATTAGG - Intronic
1178466610 21:32854063-32854085 TAGAGGTACCTCTTCAGAGGGGG - Intergenic
1179800184 21:43808085-43808107 CAGGTGGGCCTCTGCAGAGGGGG - Intergenic
1179956892 21:44745855-44745877 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1181076459 22:20381127-20381149 CTGATGAGCCTCTCCAAAGGAGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1184379601 22:44136859-44136881 TACATTAGCCCCATCAGAGGTGG + Intronic
1184530591 22:45052754-45052776 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1184890792 22:47377885-47377907 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1184917261 22:47578469-47578491 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
950557380 3:13703756-13703778 TAGATGAGCCTCCTCACATGGGG - Intergenic
950557403 3:13703877-13703899 TAGATGAGCCTCCTTACATGAGG - Intergenic
950557689 3:13705264-13705286 TAGATCAGCCTCCTCACACGGGG - Intergenic
950558632 3:13709540-13709562 TAGACCAGCCTCCTCACAGGGGG - Intergenic
950559105 3:13711769-13711791 TAGATCAGACTCTTCACATGGGG - Intergenic
950559577 3:13713944-13713966 TAGATGAGCCTCCCCAGATGGGG - Intergenic
951255825 3:20448125-20448147 TAGATGTACCTCTTCAGAGGGGG - Intergenic
952003064 3:28808995-28809017 TAGATGTACCTCTTAAGAGCAGG - Intergenic
953183873 3:40620512-40620534 CAGATTAGCCTCTTCTAAGGAGG + Intergenic
953441146 3:42918610-42918632 TAGATGTACTTCTTTAGAGGGGG - Intronic
954839517 3:53498190-53498212 TAGAACAGCCTTTTCAGTGGAGG + Intronic
955803568 3:62710338-62710360 TAAATTAGACTCTTCAGAGGTGG + Intronic
956613883 3:71152089-71152111 TAGGTGAGCCCCTTCAAAGAGGG + Intronic
957028197 3:75209143-75209165 TAGATGCACTTCTTTAGAGGAGG + Intergenic
957574622 3:81991328-81991350 TAGATGTACCTCTTTAGCGGGGG + Intergenic
957911554 3:86625173-86625195 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
958466834 3:94470065-94470087 TAGATGTGCCTCTTCAGAAGGGG - Intergenic
958632839 3:96703597-96703619 TAGATATACCTCTTCAGAGTGGG + Intergenic
959254148 3:103989426-103989448 TAGATGTTCCTCTTCAGAACGGG - Intergenic
961017015 3:123476111-123476133 TAGAGGCGCCTCTACAGAGCGGG + Intergenic
961311237 3:126003530-126003552 CAGATGTACCTCTTCAGAGGGGG + Intergenic
961343191 3:126244033-126244055 TAGATATGCCTCTTGAGAGGGGG - Intergenic
962320594 3:134387413-134387435 TAGAGGACCCTCTTCCTAGGTGG + Intergenic
962840119 3:139225546-139225568 TAGACCACCCCCTTCAGAGGGGG + Intronic
963614367 3:147517185-147517207 TACCTAAGCCTCTGCAGAGGTGG + Intergenic
963762138 3:149294903-149294925 TAGATGTGCCTCTTCAGAGTGGG + Intergenic
964927405 3:161975575-161975597 TAGGTGTACCTCTTCAAAGGTGG - Intergenic
965299779 3:166995232-166995254 TAGATGTGCCTTTTCAGATGGGG - Intergenic
966466475 3:180235484-180235506 TAGATGTACTTCTTTAGAGGGGG + Intergenic
966520438 3:180868657-180868679 TAGATGTGCCTCTTCAGAGGGGG - Intronic
968042896 3:195602703-195602725 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
968293684 3:197557035-197557057 CTGATGAGCCTCTCCAAAGGGGG - Intronic
968300964 3:197614286-197614308 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
968545098 4:1194331-1194353 TAGAGGGACCACTTCAGAGGCGG + Intronic
968641892 4:1718985-1719007 TTGATCAGCCTCCTCAGAGCGGG - Intronic
968807222 4:2782244-2782266 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
969346048 4:6570744-6570766 TAGATGGGCCTCTCCACAGATGG + Intergenic
969727050 4:8926216-8926238 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
969982058 4:11167903-11167925 AGGATGAGCCTCTACAGAGGAGG - Intergenic
970078888 4:12256933-12256955 TGGCTTAGCCTCTTCAGATGAGG - Intergenic
972802204 4:42488736-42488758 CAGATGATCCTCTGGAGAGGAGG - Intronic
974250167 4:59375320-59375342 TAGATGTACCCATTCAGAGGGGG - Intergenic
974295599 4:59994860-59994882 TAGATGTACCTCTTCAGAGGGGG - Intergenic
974697802 4:65397879-65397901 TAGATGTACCTCTTCAGAGGGGG + Intronic
975434453 4:74334963-74334985 TAGATGTACCTCTTCAGAGGAGG - Intergenic
976921595 4:90450024-90450046 TAGATGTACCTCTTCAGAAGGGG - Intronic
977130127 4:93225878-93225900 GAGATGACCCTCTCCAGATGTGG - Intronic
978356822 4:107884643-107884665 CTGATTAGCCTCTCCAGAGGCGG - Intronic
978492084 4:109320205-109320227 TAGATATACCTCTTCAGAGGGGG + Intergenic
978847783 4:113294257-113294279 TAAAGGAGCCTCCTGAGAGGGGG + Intronic
979104686 4:116668553-116668575 TAGATGTACTTCTTTAGAGGTGG + Intergenic
979188741 4:117832165-117832187 TAGATGTACTTCTTCAGAGGAGG - Intergenic
980716984 4:136639824-136639846 TAGATGTACGTCTTCAGAGGGGG + Intergenic
980722989 4:136721203-136721225 TAGATGTACTTCTTTAGAGGGGG + Intergenic
981256020 4:142660955-142660977 TAGATGTACTTCTTTAGAGGGGG + Intronic
982602996 4:157475140-157475162 TAGATGTACCTCTTCAGAGGGGG + Intergenic
982798525 4:159673749-159673771 TAGATGTGCCTTTACAGAGGGGG + Intergenic
985258328 4:188091599-188091621 AGGAAGAGCCTTTTCAGAGGGGG + Exonic
985750170 5:1669006-1669028 GTGATGAGCCTCTCCAAAGGAGG - Intergenic
986177178 5:5362635-5362657 TGGATGAGCCTCTCCAAATGAGG - Intergenic
986364835 5:7019713-7019735 TAGATGTACCTCTTCAGAGGGGG - Intergenic
987040693 5:14059510-14059532 CTGATGAGCCTCTTCAAAGGAGG - Intergenic
987576293 5:19733062-19733084 TAGATGCACCTCTTCAGAGGAGG + Intronic
987999287 5:25329832-25329854 TAGATGTACCTCTTGAGAGAGGG + Intergenic
988361262 5:30239483-30239505 TAGATGTACCTCTTCAAATGGGG + Intergenic
988603644 5:32662075-32662097 TAGATGTGCCTCTTTAGAGGGGG - Intergenic
988922898 5:35961182-35961204 TAGATTTGCCTCTGCAGAGAGGG - Intronic
989692352 5:44159265-44159287 TAGATGTACTTCTTTAGAGGGGG + Intergenic
991166570 5:63570127-63570149 TAGATATACCTCTTCAGAGCAGG + Intergenic
991452446 5:66767432-66767454 GAGAGAAGCATCTTCAGAGGAGG + Intronic
994272877 5:97802618-97802640 TAGATGTACCTCTTCAGAGGGGG - Intergenic
994448732 5:99912074-99912096 TAGATGTACCTTTTCAGAGGGGG - Intergenic
994505861 5:100642114-100642136 TAGATGTACTTCTTTAGAGGGGG + Intergenic
994665017 5:102695401-102695423 TAGATGAGCCTTTATAGATGAGG + Intergenic
995302794 5:110603545-110603567 TAGATGAGTCTGTTTAGTGGTGG + Intronic
995320661 5:110830307-110830329 TAGATGTACCTCTTCAGAGCAGG + Intergenic
995745102 5:115394356-115394378 TAGATGTACCTCTTCAGAAGCGG - Intergenic
998805188 5:145911785-145911807 CAGATGAACCTATTTAGAGGAGG - Intergenic
999684575 5:154090859-154090881 TAGCAGAGCCTCTTCAGAGAAGG + Intronic
1000289213 5:159854556-159854578 AAGAAGAACCTCTTCAGAGGTGG - Intergenic
1002658541 5:180773300-180773322 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1002703395 5:181143134-181143156 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1002703788 5:181147070-181147092 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1002792538 6:446687-446709 CAGAGGAGTCTCTTCAGTGGGGG + Intergenic
1006045158 6:31288939-31288961 TAGATGCTCCTCTTCACGGGAGG + Intronic
1006208837 6:32375588-32375610 TAGATGTACCTCTTCAGACAGGG + Intergenic
1006425594 6:33960951-33960973 TAGTTGGGCCTCCCCAGAGGTGG - Intergenic
1009626052 6:66139840-66139862 TAGATGTGTCTCTTAAGAGGAGG - Intergenic
1010010444 6:71042111-71042133 CTGATTAGCCTCTTCAAAGGAGG + Intergenic
1010571457 6:77478202-77478224 TAGATGTACCTCTTCAGAGGGGG + Intergenic
1010992014 6:82490042-82490064 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1012174221 6:96059496-96059518 TACATAAGCATCTACAGAGGAGG + Intronic
1012440108 6:99254736-99254758 TAGATGTACTTCTTCAGAAGGGG + Intergenic
1012595421 6:101032573-101032595 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1012693770 6:102352864-102352886 TAGATGTACTTCTTTAGAGGGGG - Intergenic
1012777775 6:103520250-103520272 TAGATGTTCCTCTTCATATGTGG - Intergenic
1012815855 6:104021072-104021094 TAGATGCCACTCCTCAGAGGTGG - Intergenic
1013240687 6:108242777-108242799 TAGGTGAGCCCCTTAAAAGGGGG + Intronic
1014164353 6:118206684-118206706 TAGTTGGGCCACTTGAGAGGTGG + Intronic
1014276381 6:119394639-119394661 TAGATGTGCCTCTTCAGAGGTGG - Intergenic
1015859110 6:137656797-137656819 TAGATGTACTTCTTCAGAGGGGG + Intergenic
1016119182 6:140326721-140326743 TAGATGTACCTCTTCAGAGGGGG - Intergenic
1016161958 6:140893702-140893724 TAGATGTACTTCTTTAGAGGGGG - Intergenic
1016205822 6:141467148-141467170 TAGATGTACTTCTTCAGAGGGGG - Intergenic
1017037979 6:150284311-150284333 TAAATTAGCATCTTCAGGGGTGG + Intergenic
1017622185 6:156310339-156310361 TAGCAGAGCCACTGCAGAGGTGG - Intergenic
1018065120 6:160119134-160119156 TAGGTGTACCTCTTCAGAGGGGG - Intergenic
1018140661 6:160831127-160831149 TAGAAGTGCCTCTTCTGAAGGGG + Intergenic
1018179925 6:161214077-161214099 CTGATGAGCCTCTCCAAAGGAGG - Intronic
1018362241 6:163083279-163083301 CAGATGAGCCTCTCCAAAGGAGG - Intronic
1018374571 6:163199001-163199023 CTGATGAGCCTCTCCAAAGGAGG + Intronic
1018508184 6:164494091-164494113 TAAATCAGCCTCTTGAGATGGGG + Intergenic
1019442169 7:1052931-1052953 CAGATGAGCCTCTTCAGAAGTGG - Intronic
1019822944 7:3259538-3259560 CAGATGAGCCTCTCCAAAGGAGG + Intergenic
1020763649 7:12295650-12295672 TAGACGTACCTCTTCAGAGGGGG + Intergenic
1020867096 7:13579258-13579280 TACATGGACCTCTTCAGAAGAGG - Intergenic
1021420698 7:20442278-20442300 TAGATGTGCCTCTTCAGAGAAGG + Intergenic
1021579968 7:22142083-22142105 CACAAGAGCCTCTACAGAGGAGG - Intronic
1023766033 7:43511611-43511633 TAAATGAGACTCTTCCTAGGTGG - Intronic
1024265038 7:47600011-47600033 TAGATGTACCTCTTTAAAGGGGG + Intergenic
1025757875 7:64362433-64362455 TAGATGTGCTTCTTTAGAGGGGG - Intergenic
1026362692 7:69617339-69617361 TAGATAAGGCTCCTCTGAGGAGG + Intronic
1030223674 7:107125557-107125579 TAGGAGAGCATCTTCAGAGCAGG + Intronic
1030245903 7:107384294-107384316 TAGATGTACTTCTTTAGAGGGGG + Intronic
1030387098 7:108877847-108877869 TTGATATGCCTCTTCAGAGAGGG + Intergenic
1031227211 7:119054803-119054825 TTGATTAGCCTCTTCAAAGGAGG + Intergenic
1032251566 7:130262163-130262185 TAGATGGACTTCTTTAGAGGGGG + Intergenic
1032917649 7:136510218-136510240 TAGATGTGCCTCTTTAGAGGGGG - Intergenic
1033870580 7:145749993-145750015 TACATGTACCACTTCAGAGGGGG - Intergenic
1034243718 7:149628515-149628537 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1034607226 7:152328332-152328354 TGGATGTGGCCCTTCAGAGGAGG + Intronic
1034745154 7:153517607-153517629 CAGATGAGCCTCTCTAAAGGAGG - Intergenic
1036212468 8:6853584-6853606 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1036682748 8:10887526-10887548 TAGTTGAGCCTTTACAGAAGTGG - Intergenic
1039620494 8:38992711-38992733 GAAAAGAGCCTCTACAGAGGAGG - Intronic
1040374046 8:46805981-46806003 TAGATGTACTTCTTTAGAGGGGG - Intergenic
1040868632 8:52077232-52077254 CAGATGATGCTCTTCAGAAGTGG + Intergenic
1040990847 8:53347831-53347853 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1041521746 8:58764389-58764411 TAGATGACCCTCTAATGAGGTGG + Intergenic
1041935291 8:63326179-63326201 TAGATGTGCCTCTTCAGAAGGGG + Intergenic
1042414997 8:68509082-68509104 TAGATGTACTTCTTTAGAGGGGG - Intronic
1043734360 8:83724801-83724823 TAGATGTACCTCTTCAGAGGGGG - Intergenic
1044592264 8:93925497-93925519 TATATGAAACTCTTCAGTGGTGG - Exonic
1046138836 8:110063640-110063662 TAGCTATACCTCTTCAGAGGGGG + Intergenic
1046506559 8:115145203-115145225 TAGCTCAGCCTCTTCAGTAGAGG - Intergenic
1048176163 8:132154538-132154560 TAGATGTACTTCTTTAGAGGAGG + Intronic
1048329187 8:133460753-133460775 CAGAGGAAGCTCTTCAGAGGAGG + Intronic
1048797499 8:138164587-138164609 CTGATGAGCCTCTCCAAAGGAGG - Intronic
1049440072 8:142605361-142605383 TAGGGGAGCCTCTTCATATGGGG + Intergenic
1050106278 9:2169773-2169795 TAGAAAAGCCTCTTCAGTTGAGG - Intronic
1052574904 9:30279867-30279889 TAGATGTACCTCTTCAGATGAGG - Intergenic
1052617146 9:30855427-30855449 TAGATGTGCCTCTTTAGAAGGGG + Intergenic
1053077895 9:35150651-35150673 TAGATATACCTCTTCAGAGGGGG + Intergenic
1053365352 9:37518814-37518836 TAGATCTGCCTGTCCAGAGGGGG - Intronic
1055375532 9:75645539-75645561 TAGATGTGCCTCTTCAGTCAGGG - Intergenic
1058106129 9:100973864-100973886 TAAATGTTTCTCTTCAGAGGTGG + Intergenic
1058829200 9:108800226-108800248 TAGATGTGCCTCTTCAGAGGGGG + Intergenic
1059447832 9:114349861-114349883 TAGAAGAGTATCTTCAGTGGAGG - Intronic
1059566147 9:115385153-115385175 TAGGTGTACCTCTTCAGAGGGGG + Intronic
1059888178 9:118769870-118769892 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1061683806 9:132258887-132258909 CAGATGGGCCTCTTCAGACAGGG + Intergenic
1185796771 X:2972213-2972235 TAGATGTGCCTCTCCAGAGGGGG - Intergenic
1186007874 X:5094439-5094461 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1186046393 X:5541419-5541441 CTGATGAGCCTCTCCAAAGGAGG + Intergenic
1186053824 X:5627822-5627844 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1186156195 X:6729247-6729269 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1188763316 X:34058252-34058274 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1189042131 X:37553784-37553806 TAGATGTACTTCTTTAGAGGGGG - Intronic
1189376259 X:40468437-40468459 TAGTTTAGCCTCTTGAAAGGAGG - Intergenic
1189413182 X:40791615-40791637 TAGATGTACCTCTTCAGAGGGGG - Intergenic
1189616433 X:42789045-42789067 TAGATGTACTTCTTTAGAGGTGG - Intergenic
1190814994 X:53922052-53922074 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1191594655 X:62929698-62929720 TAGATGTAGCTCTTCAGAGGAGG - Intergenic
1193269819 X:79515866-79515888 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1193330414 X:80229934-80229956 TACATGTACCTCTTCAGAGGGGG + Intergenic
1193699910 X:84747843-84747865 TAGATGTACTTCTTTAGAGGGGG + Intergenic
1193944986 X:87724015-87724037 TAGATGTGCCTCTTTAGAGGAGG - Intergenic
1194380117 X:93181104-93181126 TAGGTGTACCTCTTCAGAGGGGG + Intergenic
1195721359 X:107872043-107872065 TAGATGAGCCTCTTCAGAGGAGG - Intronic
1195853281 X:109305910-109305932 TAGATGTGCCTCTTCAGAGGGGG - Intergenic
1196158511 X:112456732-112456754 TAGATGAAGGACTTCAGAGGTGG - Exonic
1196773285 X:119316978-119317000 CTGATGAGCCTCTCCAAAGGAGG - Intergenic
1197365687 X:125562501-125562523 TAGATGTACTTCTTTAGAGGTGG - Intergenic
1197867178 X:131031312-131031334 ATTATGAACCTCTTCAGAGGTGG - Intergenic
1199255697 X:145716310-145716332 TAGATATGCTTCTTTAGAGGGGG + Intergenic
1200389118 X:155925722-155925744 CTGATGAGCCTCTCCAAAGGAGG + Intronic
1201320561 Y:12693894-12693916 CAGATGTACCTCTTCAGAGGAGG - Intergenic
1201693728 Y:16799633-16799655 CTGATTAGCCTCTCCAGAGGAGG - Intergenic
1201921182 Y:19234572-19234594 TAGATGTACCTCTTTAGAGAGGG + Intergenic
1201983197 Y:19930344-19930366 TAGATGTACTTCTTTAGAGGTGG + Intergenic
1202079566 Y:21070864-21070886 TAGATGTATCTCTTCACAGGGGG + Intergenic