ID: 1195724810

View in Genome Browser
Species Human (GRCh38)
Location X:107903630-107903652
Sequence CTGCTGTTCTTTTGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195724810_1195724818 1 Left 1195724810 X:107903630-107903652 CCCTCTTTCCAAAAGAACAGCAG 0: 1
1: 0
2: 2
3: 37
4: 349
Right 1195724818 X:107903654-107903676 AGGAAAGGGTACTGGAGTAAAGG 0: 1
1: 0
2: 1
3: 31
4: 283
1195724810_1195724819 2 Left 1195724810 X:107903630-107903652 CCCTCTTTCCAAAAGAACAGCAG 0: 1
1: 0
2: 2
3: 37
4: 349
Right 1195724819 X:107903655-107903677 GGAAAGGGTACTGGAGTAAAGGG 0: 1
1: 0
2: 1
3: 27
4: 309
1195724810_1195724821 16 Left 1195724810 X:107903630-107903652 CCCTCTTTCCAAAAGAACAGCAG 0: 1
1: 0
2: 2
3: 37
4: 349
Right 1195724821 X:107903669-107903691 AGTAAAGGGAATTGTTCAGTGGG 0: 1
1: 0
2: 2
3: 34
4: 211
1195724810_1195724820 15 Left 1195724810 X:107903630-107903652 CCCTCTTTCCAAAAGAACAGCAG 0: 1
1: 0
2: 2
3: 37
4: 349
Right 1195724820 X:107903668-107903690 GAGTAAAGGGAATTGTTCAGTGG 0: 1
1: 0
2: 0
3: 34
4: 229
1195724810_1195724817 -7 Left 1195724810 X:107903630-107903652 CCCTCTTTCCAAAAGAACAGCAG 0: 1
1: 0
2: 2
3: 37
4: 349
Right 1195724817 X:107903646-107903668 ACAGCAGGAGGAAAGGGTACTGG 0: 1
1: 0
2: 2
3: 31
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195724810 Original CRISPR CTGCTGTTCTTTTGGAAAGA GGG (reversed) Intronic
902069271 1:13719653-13719675 CTCCTGTTCTTTTTAAAAAATGG + Intronic
902738989 1:18421296-18421318 CTCCTGTGCTTTGGGAGAGATGG - Intergenic
903614067 1:24639309-24639331 TTTCTTTTCTTTTGGAGAGAGGG - Intronic
904590788 1:31614339-31614361 GGGCTGTGCTTTTGGAAAGGGGG - Intergenic
905388984 1:37624252-37624274 CTTCTTTTCTTTTAGAGAGAGGG - Intronic
906093911 1:43207043-43207065 CTGATGTTATCTTGGGAAGAAGG - Intronic
908923217 1:69221637-69221659 CTGCTATCCTTTTATAAAGAAGG - Intergenic
909611158 1:77553120-77553142 ATGGTTTTCTTTTGGAAAGAAGG + Intronic
909848060 1:80422735-80422757 CTGCAGTTGATTTTGAAAGAGGG + Intergenic
910051839 1:82983807-82983829 CTGTTGTTGTTTTGCAAAGTGGG + Intergenic
910428229 1:87136758-87136780 CAGCTGATCATTTGGAATGATGG + Intronic
910533572 1:88269866-88269888 CTGGTGTTCTTTTAAAAAAATGG + Intergenic
911039428 1:93579985-93580007 CTGCTGTACTTTTGGCCAGATGG - Intronic
913220394 1:116655373-116655395 TAGTTGTTCTTTTGGAGAGATGG - Intronic
916587331 1:166159875-166159897 CTGCTCCTCTTTTGCAGAGATGG + Intronic
916621693 1:166504788-166504810 CTGGTGTTCTTTTGCACAGAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918788768 1:188798939-188798961 CTGCTATTCTGTTGGAGATAAGG - Intergenic
919073788 1:192789745-192789767 CTGCTGTTCTTATGAAAGGGGGG + Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923103669 1:230837684-230837706 TTGCTGTGCTTTTGGAAGAAGGG - Exonic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923199021 1:231694049-231694071 CTGCTGCACTCTTGGAAACAGGG - Exonic
923203649 1:231737360-231737382 TTGCTGTTCTTTTAGTCAGATGG + Intronic
923529272 1:234800781-234800803 CTGGGGTTCTTCTGTAAAGACGG + Intergenic
924517095 1:244775211-244775233 CTCCTGTGCTTTTGGCAATAAGG - Intergenic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1063559284 10:7111522-7111544 CCCCTGTTCTTCTGGAAGGATGG + Intergenic
1065148205 10:22794574-22794596 CAGTTTTTCTTTTGGAAACATGG - Intergenic
1065473664 10:26110773-26110795 CTGATTGTCTTTTGGAAACAAGG + Intronic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1066266575 10:33781835-33781857 CAGCTGTTCTAATGGAATGAGGG + Intergenic
1066302333 10:34108127-34108149 CACCTGTCCTTTGGGAAAGATGG - Intergenic
1066414668 10:35209974-35209996 CTGCAGTTCATTTGGATTGAAGG + Intronic
1066575765 10:36823013-36823035 CTTCTCTACTTTTGGAAAGCAGG + Intergenic
1068194660 10:53700061-53700083 AGGCTGTTCTGATGGAAAGAAGG - Intergenic
1069267149 10:66474137-66474159 CTTCTGTTCTATTGCACAGACGG - Intronic
1070014087 10:72507650-72507672 CTGCTGTTGTTTTTGAGACAGGG + Intronic
1070334842 10:75446158-75446180 TTGCTGCTCTGTTGGGAAGATGG + Intronic
1070745480 10:78931229-78931251 GTGCAGTTGTTTTGAAAAGAAGG + Intergenic
1072443154 10:95475147-95475169 CTGATGTTCTTTGTGAATGATGG - Intronic
1073301761 10:102475289-102475311 CTTTTTTTTTTTTGGAAAGAGGG - Intronic
1073677658 10:105666640-105666662 CTTCTATTCTTCTGAAAAGAAGG - Intergenic
1074125416 10:110525364-110525386 CTGTCTTTCTTTTGGATAGAGGG - Intergenic
1074189543 10:111123889-111123911 CTCCTGGCCTTATGGAAAGACGG - Intergenic
1074841735 10:117359407-117359429 CTGTTGTTGTTTTTGAAACAGGG - Intronic
1075640954 10:124064398-124064420 CTGCTGTACCTTTGCAAGGATGG - Intronic
1076159909 10:128235622-128235644 CTGCTGTTCACTGGGCAAGAAGG - Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1081675545 11:44966960-44966982 CTTCTGTTCATTTGTAAAGGGGG - Intergenic
1082014119 11:47471573-47471595 CTGCTGCTCTTTTCAAAAAAGGG - Intronic
1083040959 11:59686484-59686506 CTGGTGTTCTTTTGCACAGTAGG + Intergenic
1083278703 11:61612076-61612098 CTGGTGTCCTTCTGAAAAGAAGG + Intergenic
1085795966 11:79540169-79540191 CTGGTGTCCTTTTGAGAAGAGGG + Intergenic
1087805621 11:102552320-102552342 CTGGTGTTGTTTTGGCAGGAAGG + Intergenic
1088662681 11:112063747-112063769 TTGCCTTTCTTTTGGAAGGAAGG + Exonic
1089202771 11:116734484-116734506 CTGCTGCTTTCTTGGAAACAGGG - Intergenic
1089894030 11:121909322-121909344 CTGATTTTGTTTTGGAAGGAAGG + Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1092907706 12:13116985-13117007 CAGCTGTCCTCTTGGGAAGAGGG - Intronic
1095040711 12:37437178-37437200 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1096129477 12:49146272-49146294 CTTCTATTTTTTTGGAAACACGG - Intergenic
1096320940 12:50612238-50612260 CTGCTTTTCTTTTCGAGACAGGG - Intronic
1096439258 12:51625626-51625648 CTTTTGTTTTTTTGGACAGAGGG + Intronic
1096869429 12:54584083-54584105 ATTCTTTGCTTTTGGAAAGATGG - Intronic
1097626488 12:62007906-62007928 CTTATGTTCTTTTGGACAGTAGG - Intronic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099622315 12:85019359-85019381 CTGCTGGTCTTTTGCCAAGTGGG - Intronic
1100097805 12:91064968-91064990 ATGCTTTTATTTTGGAAAGCTGG + Intergenic
1100721632 12:97365384-97365406 CTTCTTTCCTTTTGGAATGATGG + Intergenic
1101689049 12:107057886-107057908 TTGTTGTTTTTTTGGAGAGACGG - Intronic
1101795499 12:107969364-107969386 CTTCTGATCTTTTGAGAAGAAGG - Intergenic
1101982751 12:109421830-109421852 CTGCTGTTGTTTTTGAGACAGGG + Intronic
1104440641 12:128790752-128790774 ATGTTCTTCTTTTGGAAATAGGG - Intergenic
1105018322 12:132799634-132799656 CTGCTGTTTTTTCGGAGACAGGG - Intronic
1108158772 13:47616364-47616386 ATGCTTTTGTTTTGGAGAGAAGG - Intergenic
1110597844 13:77338654-77338676 CTGCTGGTCTCTTGGACTGAAGG - Intergenic
1111865387 13:93761933-93761955 CTGGTGTTCTATTGGACAGATGG - Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113088670 13:106594573-106594595 CTTTTGTTTTTTTGAAAAGAGGG - Intergenic
1115025032 14:28734218-28734240 CTACTCTTCCTTTTGAAAGATGG - Intergenic
1117346434 14:54837325-54837347 CTGCTTTTCTTTTGCTAAGGTGG + Intergenic
1117580614 14:57147991-57148013 CTACTTTTCTTTTGGGATGATGG - Intergenic
1117955690 14:61121986-61122008 TTGTTTTTCTTCTGGAAAGAGGG + Intergenic
1119053939 14:71399409-71399431 CTGCTGTTGTTTTTGAAACAGGG + Intronic
1119180484 14:72601509-72601531 CTGCTGTTCTATTGCACAGGAGG + Intergenic
1119801136 14:77446308-77446330 CTGCTTTTTTTTTAGAGAGAGGG + Intronic
1120748739 14:88177664-88177686 CTGGTGCTCTTGTGGAATGATGG + Intergenic
1120851568 14:89176793-89176815 CTGAGATGCTTTTGGAAAGAAGG - Intronic
1121037781 14:90720729-90720751 CAGCTTTTCTTTTAGAAAGATGG - Intronic
1121086735 14:91152218-91152240 CTGTTATTTTTTTGTAAAGATGG - Intronic
1121105537 14:91277175-91277197 CTGCTTATCTTTTGTAGAGACGG + Intronic
1121217943 14:92263304-92263326 CTGGGGTTTTTTTGGAAACAGGG - Intergenic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1123997330 15:25728023-25728045 CTGCTGTTGTTCTGGAAACCTGG - Intronic
1124446825 15:29742050-29742072 TTGTTGTTGTTTTGGAGAGATGG - Intronic
1125672122 15:41481181-41481203 CTGCCCTTCTTTTTGGAAGAAGG + Exonic
1127701389 15:61504812-61504834 CTGCGGGTCTTTGGGCAAGAGGG + Intergenic
1127941277 15:63698743-63698765 CTGCTGTTCCATTGCAATGATGG + Exonic
1129487187 15:75885601-75885623 AGGCTGTTCTTTTGGAAATCTGG + Intronic
1130283299 15:82535775-82535797 CTGCTTTTTTTTTGGAGACAGGG + Intergenic
1131088098 15:89595375-89595397 CTGATGTTGTTTTGGTAGGAGGG + Exonic
1132315420 15:100886715-100886737 CTTCTTTCCTTTTAGAAAGAAGG + Intronic
1132356510 15:101174806-101174828 GTGCTGTTCTTTTGCCCAGAGGG - Intergenic
1132409783 15:101568072-101568094 CAGCTGTTTTTTTGTAGAGACGG + Intergenic
1132784181 16:1645582-1645604 CTTCTGTGGTTTTGGACAGATGG + Intronic
1134030992 16:10992187-10992209 CTGGTGTTCTATTGCACAGAAGG - Intronic
1134315291 16:13113346-13113368 CTGCTGTCTCTTTGGTAAGAGGG + Intronic
1134815737 16:17204295-17204317 ATGCTTTTCTTTTGGAGAAAGGG + Intronic
1135807274 16:25554332-25554354 GTGTTGTTCTGTTGTAAAGAGGG - Intergenic
1138390423 16:56666697-56666719 CTGTTGTGTTTTTGGAATGAGGG - Intronic
1138572235 16:57883306-57883328 CTGCTGCTGTTTTGTAGAGATGG + Exonic
1138668774 16:58595986-58596008 GTGCTTTTCTTTTGGGATGAAGG + Intronic
1138811183 16:60152629-60152651 TGGCTGTTCTTCTAGAAAGATGG - Intergenic
1138891071 16:61144758-61144780 CTGAGGTTCTTTAGGAAGGAAGG + Intergenic
1141139719 16:81489505-81489527 CAGCGGCACTTTTGGAAAGAGGG - Intronic
1141703484 16:85652807-85652829 CTGCTGATCTTGTGGGGAGACGG + Intronic
1142423960 16:89990904-89990926 CTGCAGTTGCTTTGGCAAGAAGG - Intergenic
1143015214 17:3887944-3887966 CTGATGATCTTTTGGAGACAAGG - Intronic
1144232319 17:13220471-13220493 CTGCTGGGCTTCTGGGAAGAGGG + Intergenic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1147125490 17:38365126-38365148 CTGTTTTGCTTTTGGAAAGCAGG - Intronic
1148523683 17:48308230-48308252 CAGTTGTACTTTTGGAAGGATGG - Intronic
1148911975 17:50947683-50947705 CTGCTGTGTTTTTGGAGAGAGGG - Intergenic
1149396086 17:56245420-56245442 CTGCTGGACTTCTTGAAAGATGG + Intronic
1149729259 17:58928223-58928245 CTTTTTTTCTTTTGGAAACAGGG - Intronic
1150325207 17:64251513-64251535 ATAATGTTCTTTTGGAAGGAAGG - Intronic
1151754478 17:76065277-76065299 CTTTTTTTCTTTTGTAAAGATGG - Intronic
1153286054 18:3455240-3455262 CTGCTGTAGTTTTTGAAAGGTGG + Intronic
1154160252 18:11976052-11976074 CTGGTGTTCTTATGAAAAGAGGG - Intergenic
1157396509 18:47346050-47346072 CTGCTGCTCCTTGGGAAAGAGGG + Intergenic
1159274446 18:66197176-66197198 CTGCTGTTGTTTTAAACAGAAGG + Intergenic
1159520827 18:69520460-69520482 CTGCTGCTCTTTTGGAATACAGG + Intronic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1160427975 18:78791328-78791350 TTGCTGTTGTTTTTGGAAGAGGG - Intergenic
1160801222 19:970459-970481 CTTATGTTCTTTTGTAGAGATGG - Intronic
1160916721 19:1500087-1500109 CTGTTTTTCTTTTGGAGACAAGG - Intergenic
1161729736 19:5952003-5952025 TTTCTGTGCTTTAGGAAAGAGGG + Intronic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165961026 19:39534328-39534350 CTACAGTTCTCTTGGAGAGATGG + Intergenic
1166396128 19:42442602-42442624 TTGCTGTTTTTTTGTAAAGGAGG + Intronic
1167037699 19:47003833-47003855 CTGCTGCTCTTAGGGAAAGGAGG + Exonic
1167606433 19:50483179-50483201 CAACTGTTGTTTTGGCAAGACGG + Exonic
925065397 2:925793-925815 CTGCTGTTCTCTCGGAAATCAGG + Intergenic
926929863 2:18026499-18026521 CTGACCTTCTTTTGGATAGATGG + Intronic
927052255 2:19341807-19341829 ATGCTGCTCATTTGGGAAGAAGG - Intergenic
927392045 2:22606654-22606676 CTGCTCATCCTTTGGAGAGATGG + Intergenic
927618422 2:24624319-24624341 CTGATGATCTATGGGAAAGAAGG + Intronic
928212462 2:29333780-29333802 CTGCCTTTTTTTTGGAGAGATGG + Intronic
929271926 2:39982093-39982115 TTACTGTTCATTTAGAAAGAAGG + Intergenic
929287881 2:40156044-40156066 CTTCTGTTCTTCTAGAAGGAAGG - Intronic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
931209733 2:60181067-60181089 CTTTTGTTCTTTTTGAAGGAAGG - Intergenic
933231602 2:79814064-79814086 CTGCTGTCCTTTTAAGAAGAGGG - Intronic
933716542 2:85365604-85365626 CTCCTTTTCTCTTGGAATGAGGG - Intronic
935140362 2:100348046-100348068 TTGTTGTTGTTTTGGAGAGATGG - Intergenic
936437125 2:112517950-112517972 CTGCTTTTTTTTTGGAGATAGGG + Intronic
936605465 2:113948166-113948188 CTTGTTTTCTTTTGGAAACAGGG + Intronic
937376459 2:121339224-121339246 CTGATGTTGATTTGGAAACATGG - Exonic
937599782 2:123717381-123717403 CTTGTGTACTTTTGGTAAGAAGG - Intergenic
937769500 2:125703402-125703424 CTGCTTTTATTTTGTAGAGATGG + Intergenic
938041557 2:128080287-128080309 CTGCTGGTCTCTTGACAAGAAGG - Intergenic
938633662 2:133197644-133197666 TTGCTCTTCTTTTGAAAAGAAGG - Intronic
939915861 2:148042502-148042524 CTGTTGTTATTTTTGAAAGCTGG - Intronic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
940219751 2:151339664-151339686 ATACTGCTCTTTTGGTAAGATGG + Intergenic
940672922 2:156692867-156692889 ATCCTGTTCGTTTGGAAAAAAGG + Intergenic
941262269 2:163312609-163312631 CAACTGTTCTTTTTTAAAGAAGG - Intergenic
941868050 2:170355050-170355072 CTGCTGCTTTTTTGGAGAGATGG - Intronic
942162553 2:173207010-173207032 CTGCTGTTCTTTTGCAATGAGGG + Intronic
942455354 2:176134666-176134688 CTGCTTTTATTTGGGTAAGATGG + Intergenic
943166252 2:184329892-184329914 CTGCTGTCTTTTTGCAATGAAGG + Intergenic
945302864 2:208230468-208230490 TTACTGACCTTTTGGAAAGATGG - Intergenic
945357674 2:208858217-208858239 GTGCTGCTCTCGTGGAAAGAAGG - Intergenic
945515305 2:210756689-210756711 CTGAAGTTATTTTGGAAGGATGG + Intergenic
946567425 2:220982282-220982304 GAGCTGTTCTTTTTCAAAGACGG - Intergenic
946681791 2:222224850-222224872 CTGCTATTCTTTTCAAAACAAGG - Intronic
947240708 2:227991213-227991235 GGGCTGTCCCTTTGGAAAGAAGG - Intronic
947307997 2:228768344-228768366 CTGCTGTTCTTATGGTAATGAGG - Intergenic
947945608 2:234099298-234099320 CTGGTGTCTTTATGGAAAGAGGG + Intergenic
1168890948 20:1295111-1295133 CTGCTGTTAATGTGGAAGGAGGG + Intronic
1169573338 20:6930348-6930370 CTACTATTCTTTTGTAAAGTAGG + Intergenic
1170155069 20:13261885-13261907 CTGGTGTTCTGTTGGTGAGAGGG - Intronic
1170764046 20:19275101-19275123 CTGCTTTTCTTTTTGAAAACTGG - Intronic
1171526356 20:25814710-25814732 CTGATATTCTTTTGGGAAGCTGG + Intronic
1171535260 20:25881790-25881812 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1171550471 20:26041175-26041197 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1171572594 20:26268106-26268128 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1171838273 20:30177335-30177357 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1172907983 20:38383491-38383513 TTGCTTTTATTTTGGAAAGAAGG + Intergenic
1173040993 20:39462408-39462430 CTGCTTTTCTTTTTAAAAGTGGG - Intergenic
1173119479 20:40275815-40275837 CTGCTGTATTTTTGGAAACGGGG - Intergenic
1176123795 20:63466178-63466200 CGGCTGTTCACTTGGAACGAAGG - Intronic
1177665151 21:24147230-24147252 CTCCTGTACCTATGGAAAGAGGG + Intergenic
1177845320 21:26282023-26282045 ATGCTTTTCTTTTGGAAAGTGGG + Intergenic
1177990843 21:28034505-28034527 CTGCAGCTGTTTTGGAAATATGG - Intergenic
1178809613 21:35869383-35869405 CTGCTTTTCTTTTGGAGGAATGG - Intronic
1178932140 21:36828501-36828523 CTATTCTTCTTTTGGAAAAAAGG - Intronic
1180574663 22:16761375-16761397 CTGATATTCTTTTGGGAAGCTGG + Intergenic
1181481303 22:23200885-23200907 GGGCTGTTCATTTGGAAAAAAGG + Intronic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
1184163802 22:42715549-42715571 CTGCTAATTTTTTGCAAAGAAGG - Intronic
1184929146 22:47667838-47667860 CTGCTTTTCTTATGGAAGGAGGG + Intergenic
949619488 3:5794310-5794332 CTTATGTTCTTTTGGCAATAGGG - Intergenic
949765027 3:7516694-7516716 CTGCTGTTCCTTTCCAAATAGGG + Intronic
952018054 3:28983068-28983090 CTCCTGTTCCTTTTGAAAGTTGG - Intergenic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
953706076 3:45231426-45231448 CTTCTGCTCTTCTGGAGAGATGG + Intergenic
953987774 3:47458662-47458684 TTGGTGTTCTATTGTAAAGAGGG - Intronic
954384637 3:50237660-50237682 CAGCTGGCCTTTTGCAAAGACGG + Intronic
954420140 3:50414519-50414541 CTGCTATTGTTTTGGAAGGGGGG - Intronic
954618236 3:51981214-51981236 CTGGTGTGCTGTGGGAAAGACGG + Intronic
955918858 3:63933666-63933688 CTACTTTTCTTTTGCAAAAAAGG + Intronic
956986360 3:74705851-74705873 TTGTTGTTCTTTTGTTAAGATGG - Intergenic
959573003 3:107905835-107905857 CTTCTTTTCTTTTTAAAAGAAGG - Intergenic
961069024 3:123903906-123903928 CAGCAGTTCTCTTGGAGAGAAGG + Intronic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
964917954 3:161858651-161858673 CAGCTGTGCTCTTTGAAAGAGGG - Intergenic
965441399 3:168719636-168719658 CTTCAGTGCTTTTGGAAAAAGGG - Intergenic
965853534 3:173060844-173060866 ATGCTTTTCTTTTGGAAATATGG + Intronic
965942433 3:174201234-174201256 TTCCTGTTCTTTTCGAAAGAGGG - Intronic
966948727 3:184796708-184796730 CTGCTGTTCTGTCAGGAAGAAGG - Intergenic
967786082 3:193497989-193498011 CTGTTGTTCTTTTGCAGAGCAGG + Intronic
969913709 4:10468842-10468864 GTGGTGTTCTCTAGGAAAGAAGG + Intergenic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
970443366 4:16104099-16104121 CTGGTGTGCTTTTATAAAGAGGG - Intergenic
971235857 4:24841772-24841794 CTGCTGTGTTTTTGCAGAGAAGG - Intronic
972970454 4:44568541-44568563 CCGTTGTTCTTTTGGAAGCAAGG - Intergenic
973550426 4:52029725-52029747 CTACTGTGCTTTTATAAAGAGGG + Exonic
973791400 4:54381219-54381241 TTCCTGGTATTTTGGAAAGATGG + Intergenic
973850268 4:54954983-54955005 TCTCTGTTCCTTTGGAAAGATGG + Intergenic
974849919 4:67391932-67391954 CTCCTGTTCATTCGGAAAGCTGG + Intergenic
975668451 4:76756109-76756131 GTGCTGTTGTTTTCTAAAGAAGG + Intronic
977170831 4:93760255-93760277 TTGCTATTCTTTTGGAAAATAGG + Intronic
979934997 4:126682188-126682210 CTGCTGTTTTTTTTTAAAGAAGG - Intergenic
980108346 4:128609882-128609904 TTGTTTTTCTTTTGGAAACAGGG - Intergenic
982913749 4:161178979-161179001 CTGATGTTCTTTTAAAAAGGGGG - Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984896819 4:184548630-184548652 CTGCTGTTCCCTTCGAAGGAGGG - Intergenic
984928708 4:184827721-184827743 CTGGTGTCCTTATAGAAAGAAGG - Intergenic
985375629 4:189334523-189334545 CTGGTGTTCTATTGCAAAGTAGG - Intergenic
987197605 5:15543091-15543113 CTGATTTTCTTTTGGAAATGTGG - Intronic
987634328 5:20520101-20520123 CAGATGTCCTTTTGAAAAGAGGG + Intronic
988908937 5:35820404-35820426 CTTCTGCACTTTTGGAGAGAGGG - Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
989209259 5:38843934-38843956 CTGCTGTACTTCTGAAAAGGGGG - Intergenic
989332796 5:40279281-40279303 CTCCTGTTCTTATGTAAAGGAGG - Intergenic
989988143 5:50727364-50727386 TTGGTGTTCTTTTGAAAAAATGG + Intronic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
990407605 5:55507097-55507119 CTAATGATCTTTTGTAAAGAAGG - Intronic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
991262887 5:64685900-64685922 CTGCTTTTCTCTGGGAATGAGGG + Intergenic
991358228 5:65792135-65792157 CTACTTTTCTTTTTCAAAGATGG - Intronic
992090890 5:73315871-73315893 TTGTTGTTGTTTTGGAAACAGGG + Intergenic
992560057 5:77942675-77942697 CTGCTGATTTTTTGTAGAGACGG - Intergenic
992841731 5:80701992-80702014 CTGTTGTTTTTTCAGAAAGAAGG - Intronic
992925556 5:81582133-81582155 ATGCTTTTATTTTGTAAAGATGG - Intronic
993132007 5:83910436-83910458 CTGGTTTTATTTTGGAAACAGGG + Intergenic
993589289 5:89774661-89774683 CTGCTGATATTTTTGAAACAAGG + Intergenic
993630073 5:90275932-90275954 CTTCTGTTCCTATGCAAAGAAGG + Intergenic
994819062 5:104624930-104624952 CTGCTGTTGAATTGGGAAGAAGG + Intergenic
995037309 5:107549528-107549550 CTGGGGTTCTTTTGAACAGATGG + Intronic
996502742 5:124234929-124234951 ATGCTTTTCTTTTGCAAATAAGG + Intergenic
996892988 5:128444666-128444688 CCTATGTTCTTTAGGAAAGAGGG - Intronic
997164008 5:131639235-131639257 TTGCAGTTATTCTGGAAAGATGG - Intronic
998508589 5:142692328-142692350 CTGCTATTCTTTTTGAGACAGGG - Intronic
998897943 5:146820121-146820143 CTGGTGTTCTGTTGCACAGAAGG + Intronic
999578721 5:153010327-153010349 CAGCTTATCTTTTGGAAAGCAGG + Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
999991318 5:157052837-157052859 CTGCTTTTCTTTTGGAAGGAGGG - Intronic
1000604266 5:163311643-163311665 CTGCTACAGTTTTGGAAAGAGGG - Intergenic
1001681653 5:173562306-173562328 CGGGTGTTATTTTGGAAAGGAGG + Intergenic
1001778283 5:174345439-174345461 CTGGTGTTCTTTTAAGAAGAAGG - Intergenic
1002812604 6:647254-647276 CTACTGTTTTTCTGGAAACAAGG - Intronic
1003508352 6:6758819-6758841 TTTCTTTTTTTTTGGAAAGAAGG - Intergenic
1003552480 6:7110648-7110670 CTCCTTTTCTTTTGTAAAAATGG - Intronic
1003616265 6:7657863-7657885 CTGCCAATCTTTTGGAAGGAGGG + Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005316014 6:24603601-24603623 CTGCAGTGCTTCTGGAAACAGGG - Intronic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1005368903 6:25109133-25109155 CTGCTTTTCATATGAAAAGATGG - Intergenic
1007131923 6:39483181-39483203 CTGCTGATCTTTTGGGGAAAGGG + Intronic
1007964004 6:45986780-45986802 CTGCTGTACTTGTGGAATGCAGG - Intronic
1007976227 6:46104206-46104228 GTGCTGTTCTGTCAGAAAGATGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009481284 6:64160908-64160930 CTGCTGTTCCATTGCCAAGAAGG + Intronic
1009909307 6:69905477-69905499 CCGCTGTTCATCTGCAAAGATGG + Intronic
1010255093 6:73748518-73748540 CTTCTGATCTAGTGGAAAGAAGG - Intronic
1010628951 6:78174581-78174603 TTGCTGTTCTGTTCCAAAGAGGG + Intergenic
1012189533 6:96262174-96262196 CTCCTTTGCTTTTGGAAAGAGGG + Intergenic
1012191454 6:96285376-96285398 CTTCAGCTCTTTGGGAAAGACGG + Intergenic
1012330115 6:97974443-97974465 GTGCTTTTCATTTGAAAAGATGG + Intergenic
1012494702 6:99821486-99821508 CCTCTGTTCATTTGCAAAGATGG - Intergenic
1012848885 6:104424013-104424035 TCGCTCTTCTTTTGGAAGGAAGG + Intergenic
1013763870 6:113551643-113551665 CTGGTGTTCTTTTGCACAGTAGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014366101 6:120544120-120544142 CTGCTGCTCTTTTCTAAGGATGG + Intergenic
1014469818 6:121800407-121800429 CTGCTTTTCTTTTGCTCAGAAGG + Intergenic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1015490790 6:133823376-133823398 TTGCTTTTTTTTTGGTAAGATGG - Intergenic
1016397648 6:143642652-143642674 CTGGTGTTCTTATAAAAAGAGGG + Intronic
1017873804 6:158507031-158507053 CTGCTATTCTTTTAGACATAGGG + Exonic
1018390007 6:163335087-163335109 CTGGTGTCCTTATAGAAAGAAGG + Intergenic
1019334523 7:476700-476722 CTGCTGTCCTCATGGAAAGGGGG + Intergenic
1020755538 7:12197888-12197910 TTGCTTTTTTTTTGGAAACAGGG + Intergenic
1020909267 7:14108471-14108493 ATGCTGTTCTTTTGGAATGGGGG + Intergenic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1022081734 7:27029229-27029251 CTACTTTTCTTTTTTAAAGAGGG + Intergenic
1022306230 7:29149015-29149037 ATGCTGTGCTCTTGGACAGATGG + Intronic
1022748516 7:33199092-33199114 GTTCTTTTCTTTTTGAAAGATGG + Intronic
1022825622 7:34009654-34009676 CTGCTGCTCTTTTGGAAGAGGGG + Intronic
1023003783 7:35840263-35840285 CTTCTTTTCTTTTTGAAACAAGG + Intronic
1024029196 7:45442676-45442698 CTCCTGTTTTTTTGGAAAGCTGG + Intergenic
1024958021 7:54946412-54946434 ATGCTGCTCTTTTGGGAGGATGG + Intergenic
1026363477 7:69624771-69624793 CTGGTATACTTTTGGGAAGATGG - Intronic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1028548487 7:92029609-92029631 CGACTGTTTTTTTGGAAAGATGG - Intronic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1028932249 7:96426561-96426583 CTGGGGCCCTTTTGGAAAGAAGG - Intergenic
1031478352 7:122249266-122249288 CTGATGTCCTTTTAAAAAGAGGG + Intergenic
1031804033 7:126285933-126285955 CTGGTGTTCTATTGTAAAGTAGG + Intergenic
1032129791 7:129218669-129218691 CAGCTGTTTTTTTGGAGACAGGG - Intergenic
1032563279 7:132914325-132914347 CTCCTTTTCTTTGGAAAAGATGG - Intronic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033069106 7:138185740-138185762 CTGGTGTTCTTATAAAAAGAAGG - Intergenic
1033094044 7:138414232-138414254 GTGGTGTTCTTTTAGAAAGGAGG - Intergenic
1034096013 7:148408355-148408377 CTCCTCTTCTCTTGGAAATATGG - Intronic
1034464965 7:151222043-151222065 ATGCTTTACTTTTTGAAAGAAGG + Intronic
1034900643 7:154906119-154906141 CTGCTGTCCTTATGAAAAGGGGG - Intergenic
1035086034 7:156258713-156258735 CTGGTGTCCTTTTATAAAGAGGG - Intergenic
1035109896 7:156472366-156472388 ATGATGATCTTTTGGAAACAGGG - Intergenic
1035741203 8:1929856-1929878 CTGCTGTTCTCTTGGCCACAGGG + Intronic
1036481784 8:9146540-9146562 GTTCTGTACTTTTGGAAAAATGG - Intronic
1037077824 8:14743739-14743761 CTGGTTTTCTTTTTGCAAGACGG - Intronic
1037158743 8:15740492-15740514 CAACTGTGCTTTTGGAAAAACGG + Intronic
1037269159 8:17106962-17106984 CTGTTATTCTTCTGGAGAGAAGG - Intronic
1037888159 8:22605922-22605944 CTGATGTTCCTCTGGAAAGCAGG + Intronic
1039507151 8:38060221-38060243 CTGCTGATCATTCGGAAGGAAGG - Exonic
1040799298 8:51323457-51323479 TTGCTGTTGTTTTGTAAAGATGG + Intronic
1041058276 8:54010291-54010313 CTGCTATTTTTTTTTAAAGATGG - Intronic
1041670774 8:60489591-60489613 CTGCTTCTCGTTTGAAAAGAGGG - Intergenic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1044370103 8:91400227-91400249 CTAGTGTTTTTTTGGAAAGTAGG - Intergenic
1044432576 8:92126048-92126070 CTTCTTTTCTTTTTGAGAGAAGG - Intergenic
1044454103 8:92371909-92371931 CTTCTCTTGTTTTTGAAAGAGGG - Intergenic
1046021549 8:108671455-108671477 CTGCTTTTCTTTTGGGCACAGGG - Intronic
1046998995 8:120554935-120554957 TTGGTGTTCTTTTGTAAGGAAGG - Intronic
1048379890 8:133856185-133856207 CAGCTGCTCTGTTGGAAATAGGG - Intergenic
1048387358 8:133924692-133924714 CTTCTCTCCATTTGGAAAGAGGG + Intergenic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1049409919 8:142468353-142468375 CCGTTGGTCTTGTGGAAAGACGG + Intronic
1049632027 8:143664084-143664106 CTGGCGTTCTTTTTGAAAGCAGG + Intergenic
1050022421 9:1298489-1298511 CTGCTGCTCCTTTGGGTAGAAGG - Intergenic
1050249547 9:3730085-3730107 CAGCTGATCTTTTGAAAGGAAGG + Intergenic
1051177338 9:14374258-14374280 CTTCTTTTCTTTGGGAAGGAGGG - Intronic
1051210939 9:14742572-14742594 TTGCTGTCCTTGTGGAAATATGG + Intronic
1051818014 9:21132562-21132584 CTGCTGATATTTTAGAAAGAGGG + Intergenic
1053360023 9:37478985-37479007 CCGCTGTACCTTTGGAATGACGG - Intergenic
1053362380 9:37498004-37498026 CTGCTGTTCTCGTTGTAAGAGGG + Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055687143 9:78787872-78787894 CTGCAGTTCTTTTAGAAAGTTGG - Intergenic
1057261970 9:93589843-93589865 CTGCTGTTTGTGTGGAGAGAGGG - Intronic
1058239920 9:102544380-102544402 CTGCTCTTCTTCTGGAATGAGGG - Intergenic
1062511764 9:136910087-136910109 CTGCTGTTCCTTTGGGCACAAGG - Intronic
1185554010 X:1006247-1006269 CTGCTGTTTTTTTGGTTAGTTGG + Intergenic
1186235030 X:7498501-7498523 CTGCTCTCATTTTGGAAAGAAGG + Intergenic
1186504052 X:10075852-10075874 CTTCTTTTCTTTTGGAGACAGGG - Intronic
1189024742 X:37381078-37381100 CTGCTGTTCTTTTTGGAGAAGGG + Intronic
1189595392 X:42559580-42559602 CTCCTGTTCTTTTTTGAAGAAGG - Intergenic
1191778547 X:64844167-64844189 CTCCTTTTCTTCTGGAAGGAAGG - Intergenic
1192070877 X:67940182-67940204 CTGCTGTCTTTCTGGATAGAAGG - Intergenic
1194279927 X:91938046-91938068 TTACCTTTCTTTTGGAAAGATGG - Intronic
1194285631 X:92007347-92007369 CTCCTCTGCCTTTGGAAAGAGGG - Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196039689 X:111188563-111188585 CCTCTGTCCTTTTGGAAATAGGG + Intronic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1198786415 X:140293199-140293221 CTGCTTTTCTCTTCTAAAGAAGG - Intergenic
1200597406 Y:5161546-5161568 TTACCTTTCTTTTGGAAAGATGG - Intronic
1200603196 Y:5231886-5231908 CTCCTCTGCCTTTGGAAAGAGGG - Intronic
1200764556 Y:7069539-7069561 CTGCTGTTCTCATGAAAAGAGGG - Intronic
1202044951 Y:20728588-20728610 CTGCTGTTCTCATGAAAAGAGGG - Intergenic