ID: 1195728639

View in Genome Browser
Species Human (GRCh38)
Location X:107942749-107942771
Sequence TAAAGCATTTAGAGTGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195728639_1195728640 8 Left 1195728639 X:107942749-107942771 CCAACATCACTCTAAATGCTTTA No data
Right 1195728640 X:107942780-107942802 AGTACAACAATCCATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195728639 Original CRISPR TAAAGCATTTAGAGTGATGT TGG (reversed) Intergenic
No off target data available for this crispr