ID: 1195729268

View in Genome Browser
Species Human (GRCh38)
Location X:107949273-107949295
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 2, 1: 2, 2: 9, 3: 81, 4: 571}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195729254_1195729268 29 Left 1195729254 X:107949221-107949243 CCAGCCACTTTGTTTACCTACTC 0: 254
1: 333
2: 544
3: 594
4: 1547
Right 1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG 0: 2
1: 2
2: 9
3: 81
4: 571
1195729259_1195729268 3 Left 1195729259 X:107949247-107949269 CCTCAGCTATGGCGGACTCCCCT No data
Right 1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG 0: 2
1: 2
2: 9
3: 81
4: 571
1195729257_1195729268 13 Left 1195729257 X:107949237-107949259 CCTACTCAAGCCTCAGCTATGGC 0: 8
1: 989
2: 1737
3: 1567
4: 1544
Right 1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG 0: 2
1: 2
2: 9
3: 81
4: 571
1195729253_1195729268 30 Left 1195729253 X:107949220-107949242 CCCAGCCACTTTGTTTACCTACT 0: 163
1: 648
2: 889
3: 1166
4: 1456
Right 1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG 0: 2
1: 2
2: 9
3: 81
4: 571
1195729255_1195729268 25 Left 1195729255 X:107949225-107949247 CCACTTTGTTTACCTACTCAAGC 0: 1004
1: 573
2: 274
3: 71
4: 153
Right 1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG 0: 2
1: 2
2: 9
3: 81
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195729268 Original CRISPR CCTGCCAGGCTGCTGCCTCA CGG Intergenic
900108359 1:995709-995731 CATGCCTGGCTGCTGCCCCACGG - Intergenic
900362760 1:2297881-2297903 CCTGCCAGGCTGCAGCCACGGGG - Intronic
900400909 1:2472535-2472557 CCTGGGATGCGGCTGCCTCAGGG + Intronic
900427461 1:2587069-2587091 CCTGCCGGGCGGCTGGGTCATGG - Exonic
900981178 1:6047225-6047247 ACTGCCGGGCTCCTGCCTCAGGG - Intronic
901434465 1:9238218-9238240 CCGCCCAGCCTCCTGCCTCAGGG - Intronic
901844274 1:11972078-11972100 CGTGCCTGGGTCCTGCCTCAGGG + Intronic
902397763 1:16141766-16141788 CCTGCCTGCCTGCTGCCGCCAGG + Intronic
903101487 1:21034890-21034912 CCTGCCAGGGTGGCGCCTCTGGG - Intronic
903349427 1:22709420-22709442 CCTCCCAGGCTGCCTCCTCCTGG + Intergenic
903864974 1:26391467-26391489 CCTGCCCTGCTGGTGCCACAAGG + Intergenic
905944555 1:41890739-41890761 CTGGCCAGGCAGCTGCCTGAAGG + Intronic
906026922 1:42682118-42682140 CCAGCCCGGCGGCTGCCTCGTGG + Intergenic
907399719 1:54217419-54217441 CCTTCCAGGATACTGACTCAGGG + Intronic
907597000 1:55729185-55729207 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
908737242 1:67289627-67289649 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
910639297 1:89442432-89442454 CTTGCCTGGCAACTGCCTCACGG + Intergenic
910831484 1:91466181-91466203 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
911183431 1:94881199-94881221 CCTGCCAGGCTGCTTGGTGAAGG - Intronic
912066705 1:105754131-105754153 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
912313365 1:108645245-108645267 ACTGCCAACCTGCTGCCCCACGG - Intergenic
912386736 1:109274565-109274587 CCTGCCCGGGTGCAGCCTGAAGG - Exonic
912492367 1:110069477-110069499 CCTGCCAGGCCCCTGCCTTCAGG + Intronic
912944150 1:114070641-114070663 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
914510738 1:148329801-148329823 CCTGCCAGGACCCTGCCCCAAGG + Intergenic
915072898 1:153287050-153287072 CCAGGCAGGCTTCTGCCTCAGGG - Intergenic
915135419 1:153728190-153728212 CCTTCCTGGCTGATGCCCCAAGG - Exonic
915663427 1:157422978-157423000 CCAGGCATGCTCCTGCCTCAAGG + Intergenic
916362314 1:163984460-163984482 CCAGCCAGTCTCCTGCCTCAGGG - Intergenic
916752370 1:167734732-167734754 CTTGCAATGCAGCTGCCTCAGGG + Intronic
916785680 1:168085495-168085517 CCTCTCAGGCTGCAGCCCCACGG + Exonic
917294518 1:173504948-173504970 CCTGGTAGGCTGCAGCCACATGG - Intronic
917764377 1:178200936-178200958 CTTGCCAGGCACCGGCCTCAGGG - Intronic
918907721 1:190519820-190519842 CATGCCATTCTCCTGCCTCAGGG - Intergenic
919241483 1:194922033-194922055 CTTGCCTGGCAACTGCCTCAAGG - Intergenic
919655777 1:200196014-200196036 CCAGCAATGCTTCTGCCTCAAGG - Intergenic
919769434 1:201147822-201147844 TCTGCCAGGCTGCTCTCTGAAGG + Intronic
919820257 1:201468140-201468162 CCGGCCAACCTGGTGCCTCAGGG + Intronic
919990818 1:202707936-202707958 CCTGCCTGGAAGCTGCCTAAGGG + Intronic
920224223 1:204426367-204426389 CCTGGCAGGCTCCTGGCTCTGGG + Intronic
922720783 1:227899293-227899315 CCTGCCTGGCCGCTGACACAGGG + Intergenic
923209060 1:231786868-231786890 CCTGGCAGGATGCAGCCTCCTGG + Intronic
923772243 1:236947886-236947908 ACTGCCTGCCTGCCGCCTCACGG - Intergenic
924739147 1:246784747-246784769 GCTGCCAAGATGCTGCCCCAGGG - Intergenic
924847509 1:247787999-247788021 CTTGCCTGGCAGCTGCCTCAGGG + Intergenic
1062770811 10:99146-99168 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1062774750 10:135635-135657 CCTGCCTGGCCGCGGCCTCTGGG + Intronic
1064342218 10:14497710-14497732 ACTGCCATGCTGCTTCCTCCCGG - Intergenic
1064657210 10:17568122-17568144 CCAACCATGCTCCTGCCTCAAGG - Intergenic
1065817123 10:29492371-29492393 GCCGCCAGGCCGCTGCCTGACGG + Intronic
1066169398 10:32826088-32826110 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG + Intergenic
1067338255 10:45381120-45381142 CCTGCCAGGCTCCTGCTTCCAGG - Intronic
1067431546 10:46249085-46249107 CCTGCCAGGCCCCTCCCCCAGGG - Intergenic
1067552175 10:47243874-47243896 ACAGCCAGCCTTCTGCCTCAAGG + Intergenic
1068894238 10:62181774-62181796 CCTGGCATGCTCTTGCCTCAGGG - Intergenic
1069192637 10:65508823-65508845 CCTGCCTGGCACCTGCCTCAGGG + Intergenic
1070797115 10:79223300-79223322 CCTGCCTGCCTGCTGTCTCTGGG - Intronic
1070820669 10:79352261-79352283 CCTCCCAGGCAGGTGCCTCCAGG + Intronic
1071066721 10:81644690-81644712 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1071674230 10:87639678-87639700 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1072424311 10:95316517-95316539 CCTGCCAGGCAGCTGGGTAAAGG - Intronic
1075704288 10:124490260-124490282 ACTGGCAGGCTGCGGCCTAAAGG - Intronic
1076192055 10:128489948-128489970 GCTGCCAGGTTGCTGTCTCTGGG - Intergenic
1076328326 10:129645604-129645626 CTTTCCATGCTTCTGCCTCAAGG - Intronic
1076529756 10:131136447-131136469 CCTCCGTGGCTGCTGCCCCAGGG + Intronic
1076599821 10:131650335-131650357 CCGGCCTGGCCTCTGCCTCAGGG - Intergenic
1076713971 10:132354014-132354036 CCTGCCAGGAGGCTGCCTGTGGG + Intronic
1076737725 10:132466205-132466227 CCAGCCTGACTGCAGCCTCATGG - Intergenic
1076927743 10:133501701-133501723 CTTGCCTGGCATCTGCCTCAGGG + Intergenic
1077044483 11:538321-538343 CCTGCCAGCCTCGAGCCTCATGG - Intronic
1077187185 11:1240640-1240662 CCAGCCAGCCAGCTCCCTCAAGG + Intronic
1077516126 11:3003097-3003119 CCTGCCCGGGTGCTGCCTGCTGG - Intronic
1078577973 11:12517483-12517505 CCAGCCAGGCTGCTAGCTCGGGG - Intronic
1078662367 11:13297677-13297699 CCTGCCAAGCTCCTGCTTCATGG + Intronic
1079224779 11:18595790-18595812 CCTGCCAGTTGGCAGCCTCATGG - Intergenic
1079742044 11:24074185-24074207 CATGCAAGGATGCTGGCTCATGG + Intergenic
1081072467 11:38628624-38628646 TTTGCCAGGCAACTGCCTCAGGG - Intergenic
1081590055 11:44416323-44416345 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1081705447 11:45180272-45180294 CCTGCCACTCTACTGCCTCCTGG - Intronic
1081786354 11:45750535-45750557 TCTGCCATGCTGCTGCCCCAGGG - Intergenic
1082001500 11:47395698-47395720 CCTGCCAGGCAGCAGCCCCCGGG + Intergenic
1082802539 11:57425474-57425496 CAAGCTAGGCTGCTGCCTGAAGG + Intronic
1083501734 11:63115287-63115309 CCTGCAAGGCAGTAGCCTCATGG - Intronic
1083593229 11:63907268-63907290 CATGACTGGCTGCTGCCTCAAGG + Intronic
1083735063 11:64675487-64675509 CAGGCCAGGCAGCTGCCCCACGG + Intronic
1083744246 11:64726443-64726465 CCTGCTGGGCTTGTGCCTCAGGG - Intergenic
1084174522 11:67416349-67416371 CCTCCCAGGATGCAGCCGCAGGG - Intronic
1085747249 11:79125760-79125782 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1086141678 11:83506559-83506581 CTTGCCTGGCACCTGCCTCAGGG + Intronic
1086278304 11:85157983-85158005 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1086818685 11:91406583-91406605 GGTGCCAGGCAGCTGCCCCATGG - Intergenic
1088223550 11:107593139-107593161 CCTGCCAGGCTGCTTCTGCAAGG + Intronic
1088407936 11:109501156-109501178 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1089681411 11:120120997-120121019 CCACCCAGGCTGCTGCTTCCCGG + Intronic
1090037968 11:123265128-123265150 CCTGGCAGGCTTCTACTTCATGG - Intergenic
1090215087 11:124954602-124954624 CATGCCAGGCTTCTGCCTCCAGG + Intronic
1090431236 11:126648341-126648363 CCAGGCATGCTCCTGCCTCAGGG + Intronic
1091372707 11:135074014-135074036 CCTCCCAGGATCCTGCATCAGGG + Intergenic
1091387584 12:104689-104711 CCTGCCTTGCTGCTGCCTAGCGG - Intronic
1091389766 12:118895-118917 CCTGCCAGGGAGCTGACTCGGGG - Intronic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1091705176 12:2688718-2688740 CCAGCCAGGCTGGGGCCCCAGGG + Exonic
1092104234 12:5909787-5909809 CCTGCCTGGCTGCTGTATGAAGG - Intronic
1092104641 12:5912748-5912770 GGTCCCAGCCTGCTGCCTCAGGG + Intronic
1092651368 12:10638952-10638974 CCTCCCAGGTGGCTGCCACATGG + Intronic
1093032227 12:14298702-14298724 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1093900422 12:24625342-24625364 CCTGCTAGGCTGCAGCCTGGCGG - Intergenic
1094079309 12:26515624-26515646 CCTGCTTGGCTTCTGCCTGATGG - Intronic
1094482324 12:30894771-30894793 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1094763319 12:33560943-33560965 CCTACCAGGAGGTTGCCTCAAGG - Intergenic
1095140553 12:38657298-38657320 CCTGCGAGGCTGCAGCCTGGTGG + Intronic
1096186633 12:49585892-49585914 CTGCCCAGGCTGCTACCTCAGGG - Intronic
1096882840 12:54686552-54686574 CGTGCCAGGATGCTGCCCCTTGG - Intergenic
1097821761 12:64134994-64135016 CTTGCCTGGCAGCTGCCTCATGG + Intronic
1098749513 12:74277008-74277030 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1099148114 12:79073611-79073633 CCTACCATTCTTCTGCCTCAGGG - Intronic
1099184113 12:79499155-79499177 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1099350696 12:81565224-81565246 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1099365608 12:81762972-81762994 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
1099410092 12:82314585-82314607 CCTGCAAGGCTGCAGCCTGGCGG - Intronic
1099787420 12:87284354-87284376 CAAGCCAGGCTTCTGCCTAATGG - Intergenic
1100817127 12:98397288-98397310 CCTGCCTACCTGCTGCCTGAGGG - Intergenic
1101263797 12:103063624-103063646 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1102245457 12:111353062-111353084 CCTGCCAGCCTGGTCCCACAGGG - Intergenic
1103204295 12:119116346-119116368 CTTGCCAGGCTGCGGCTGCACGG - Intronic
1103396179 12:120608963-120608985 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1103963235 12:124622339-124622361 CCTGCTCGGGTCCTGCCTCAGGG + Intergenic
1103963272 12:124622504-124622526 CCTGCTAGGGTCCTGCCTCAGGG + Intergenic
1104089900 12:125507606-125507628 CCAGCCATGCTGCTGCCTCAGGG - Intronic
1104738860 12:131157952-131157974 CCAGGCAGGCTCCTGCCTCGGGG + Intergenic
1104846624 12:131850308-131850330 CCAGCCACGCTCCTGCCCCAGGG + Intronic
1104860784 12:131922327-131922349 CCTGTCCTGCTGCTGCCACAGGG - Exonic
1104915207 12:132260857-132260879 GCGGCCAGGCTGCAGCCGCACGG + Intronic
1104993345 12:132639336-132639358 CCTCCCACGCTGCTGCCACGCGG + Intronic
1105296324 13:19090452-19090474 CATCCCAGGCTGCTGGCACAGGG - Intergenic
1105995702 13:25669880-25669902 CCTGCCTGGCTGTTCCCTGAGGG - Intronic
1106853128 13:33817097-33817119 CCTGGAAGGCTTCTGCCTCAGGG - Intergenic
1107424736 13:40281682-40281704 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1107522574 13:41198042-41198064 ACTCCCAGGCAGTTGCCTCAGGG + Intergenic
1108903926 13:55447201-55447223 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1109816227 13:67588738-67588760 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1109936968 13:69299619-69299641 CCTGCCAACCTGGGGCCTCAGGG + Intergenic
1110490945 13:76106547-76106569 CCTGCCAAGCCACTGGCTCATGG + Intergenic
1111409611 13:87857433-87857455 CCTGGCACACTGATGCCTCAAGG - Intergenic
1111929288 13:94497276-94497298 CCTGGCAGGCTGGAGACTCAGGG - Intergenic
1112032907 13:95473746-95473768 CCTGCTATGCTGCTGGTTCAGGG + Intronic
1112067533 13:95809702-95809724 GCTGCCTGGCTGCTGCCTCTTGG + Intronic
1112163451 13:96893025-96893047 CCTGGCATGCTCCTGCCTCAGGG - Intergenic
1112250257 13:97772701-97772723 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1113320039 13:109224159-109224181 CTTGCCTGACAGCTGCCTCAGGG + Intergenic
1113711705 13:112469507-112469529 CCTGCCAGGGTGGTGGCTCCTGG - Intergenic
1113876999 13:113600934-113600956 CGTGCAAGGCTTCTGTCTCATGG - Intronic
1114266353 14:21074705-21074727 CCTCCAAGACTGCTGCCTCTGGG - Exonic
1114743253 14:25119593-25119615 CCTGCCAGGTGGCAACCTCAAGG + Intergenic
1114758579 14:25286211-25286233 CCTGCCTGGCAACTGCCTCAGGG + Intergenic
1116058590 14:39894456-39894478 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1116181746 14:41543678-41543700 CCTGTCTGGCTGCTCCCCCAAGG - Intergenic
1116414753 14:44666828-44666850 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1116631657 14:47342984-47343006 CCTGGCAGAATGCTACCTCAGGG + Intronic
1117003950 14:51399272-51399294 TCTGCCAGGCTACTGCATTAAGG + Intergenic
1117216496 14:53557619-53557641 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
1117633795 14:57721894-57721916 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1118331400 14:64818524-64818546 CCAGTGAGGATGCTGCCTCAGGG - Intronic
1118420245 14:65594381-65594403 CCTACCTGGATGCTGCCACAGGG - Intronic
1118559878 14:67067676-67067698 CCTGCCAGGCTGCAGCCTGGCGG - Intronic
1118883207 14:69845996-69846018 GCTGCCGGGCTGCTGTCACATGG + Intergenic
1119390693 14:74289364-74289386 CCAGCCAGGCCGCTGATTCAAGG - Intronic
1121274157 14:92656511-92656533 CCTGCCAGCCAGCTGCCCCAAGG - Intronic
1121576821 14:94995649-94995671 CCTGCCAAGGTGGTGCCTCAGGG - Intergenic
1121727748 14:96165640-96165662 GCTGCCACGCTGCTGCCTCCAGG + Intergenic
1122079143 14:99254702-99254724 CCCTCCAGGCTTCTGCCTCCTGG - Intronic
1122693302 14:103541545-103541567 CCTGCCTGGCTGGTGCCCCCAGG + Intergenic
1122837659 14:104437957-104437979 CCTGCCTGTCTGCTCCCTCCAGG + Intergenic
1123013074 14:105358525-105358547 TCTCCCAGGCTGCAGCCCCAGGG - Intronic
1202905381 14_GL000194v1_random:68681-68703 GCTCCCAGGCTGCTGCCTCCAGG + Intergenic
1123472111 15:20562931-20562953 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123645892 15:22437422-22437444 CCTTCCCTCCTGCTGCCTCAAGG - Intergenic
1123667209 15:22617291-22617313 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1123732415 15:23157922-23157944 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123750550 15:23355304-23355326 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1124024769 15:25955204-25955226 GCTGACAAGCTGCTACCTCAAGG - Intergenic
1124282919 15:28379220-28379242 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1124299780 15:28532393-28532415 CCTTCCCTCCTGCTGCCTCAAGG - Intronic
1124321049 15:28711858-28711880 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124481448 15:30083497-30083519 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124487903 15:30135593-30135615 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124522147 15:30413697-30413719 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124536518 15:30552521-30552543 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124542992 15:30604570-30604592 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124562952 15:30792013-30792035 CCTCCCCTCCTGCTGCCTCAAGG + Intergenic
1124755626 15:32402728-32402750 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124762135 15:32455071-32455093 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124776495 15:32593997-32594019 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124960347 15:34389210-34389232 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124976976 15:34535431-34535453 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1126074502 15:44896259-44896281 CCTGCAAGGCTGCAGCCTGGTGG - Intergenic
1126098147 15:45103772-45103794 CCTGACTGGCTCCTGCCTCTGGG - Intronic
1126108223 15:45160984-45161006 CCTGCCAGGCTGGTACCTGAGGG - Exonic
1127193727 15:56561810-56561832 CCGGCCAGGCTTCAGCCTCCAGG - Intergenic
1128176061 15:65556675-65556697 CCTGGCATGGTGCTGCTTCAGGG + Intronic
1128186094 15:65644582-65644604 CCTGGCTGGCTGCTGCCTCCAGG - Intronic
1128346323 15:66854714-66854736 CGTCCCAGGCTCCTGCCTCCTGG - Intergenic
1129228823 15:74185123-74185145 CCTGCCAGGGTGGTGCCTTGTGG + Intronic
1129238874 15:74240132-74240154 ACTGCCAGGCTGGCGCCTCCTGG - Intronic
1129379058 15:75154178-75154200 CCAGCCATGCTGCTGGGTCAGGG + Intergenic
1131064576 15:89425912-89425934 CATGGCAGGCTGCTGCCGCTGGG + Intergenic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132312072 15:100864562-100864584 CCTCCCTGGCTGCTGCTTCAGGG + Intergenic
1132433890 15:101781508-101781530 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1135649955 16:24197419-24197441 CCAGGCAAGCTCCTGCCTCAGGG - Intronic
1136008390 16:27346691-27346713 CCTCCCAGGCTCCTGGCTCCAGG - Intronic
1136111524 16:28066501-28066523 CCAGACAGGCTCCTGCCTCGAGG - Intergenic
1136147125 16:28322215-28322237 CCTCCCAGGCAGCTGTCCCAGGG + Exonic
1136297057 16:29309621-29309643 GCTACCAGGCAGCTGCCGCAGGG + Intergenic
1136377441 16:29873613-29873635 CCTGCCAGGGTACAGCCTCGAGG - Exonic
1136635768 16:31521923-31521945 CCAGCCTGGATGCTGCCTCCAGG + Intergenic
1136638245 16:31539575-31539597 CCAGCCTGGATGCTGCCTCCAGG - Intergenic
1137223717 16:46481896-46481918 CCTGCCTAGTTGCTCCCTCAAGG + Intergenic
1137457675 16:48630596-48630618 AATGCCAGGCTGCTGCCACAAGG - Intergenic
1137461508 16:48668363-48668385 CCTGCTAGGCTGCAGCCTGTCGG - Intergenic
1138047623 16:53742259-53742281 CCTGCCAGGCCAATGCCTGAAGG - Intronic
1138474583 16:57263268-57263290 CCTGTCAGGCTGTTCCCACACGG + Intronic
1138521729 16:57575110-57575132 CCTGCCAGGTAGCTTCCTCCAGG - Intronic
1139534937 16:67565923-67565945 CCTTGCAGGCTGGTGCCTCCTGG + Intronic
1140278153 16:73529524-73529546 CCTGCTTGGCTCCTGCCTCCTGG + Intergenic
1140622437 16:76751692-76751714 CCATCCAGGCTACTGCATCAGGG + Intergenic
1141414015 16:83856035-83856057 GAGGCCAGGCTGCTGCCCCAGGG + Intergenic
1141630916 16:85287524-85287546 CCAGCCACGCCGCTGCCTCAGGG + Intergenic
1141764032 16:86046959-86046981 CCCCCCAGGCTGCTGCCTCCCGG - Intergenic
1141922264 16:87143987-87144009 CCTGGGAGGCTGCAGACTCATGG + Intronic
1142058607 16:88015725-88015747 GCTACCAGGCAGCTGCCGCAGGG + Intronic
1142193118 16:88726958-88726980 CCTGCCAGGCCGGAGCGTCAGGG + Exonic
1142268516 16:89077345-89077367 CCAGCCCAGCTCCTGCCTCAAGG + Intergenic
1142317566 16:89357763-89357785 CCTCCCAGACTCCTCCCTCAGGG - Intronic
1142716124 17:1747908-1747930 CCAGACAGCCTCCTGCCTCATGG - Intronic
1142807555 17:2379528-2379550 TCTGCACGGCTGCTGCCTCCTGG - Exonic
1143022319 17:3923201-3923223 TCTCCCAGGCTGTTTCCTCAGGG + Intergenic
1143150768 17:4806859-4806881 CGTGCCCGGCCGCTGCCTCCCGG - Intergenic
1144330853 17:14222850-14222872 CCAGACAGGTTTCTGCCTCAGGG + Intergenic
1144763290 17:17719376-17719398 CCAGCCTGGCTGCTGCCTCAGGG + Intronic
1145193256 17:20866532-20866554 CCTACCAGGCTCCTACCTCCAGG + Exonic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1146237871 17:31185137-31185159 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1146393700 17:32444824-32444846 CCTCGCCGGCTGCTGACTCACGG + Intronic
1146654813 17:34628902-34628924 CCTCCCCGGCAGCTGCCTGATGG - Intronic
1146758502 17:35454671-35454693 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1146912092 17:36655407-36655429 CCTGCCTGCCTGCTCACTCAGGG + Intergenic
1147037917 17:37695494-37695516 CCTACCAGGATACTGCCTAATGG + Intronic
1147537984 17:41333352-41333374 CCGGTCATGCTCCTGCCTCAGGG - Intergenic
1149540508 17:57464670-57464692 CCTCCCACGCTGCTGCCCCTTGG + Intronic
1149998470 17:61417143-61417165 CCTGCCTGACTGCCGCCTCCCGG + Intergenic
1150283647 17:63943691-63943713 GCTGCCAGGCTCCTGCCTAGGGG - Intronic
1150813910 17:68377958-68377980 CCTGAAAGGCTGCTGCCTGGGGG + Intronic
1151037944 17:70822701-70822723 CTTGCCTGGCAACTGCCTCATGG + Intergenic
1151252266 17:72845378-72845400 CCAGACATGCTCCTGCCTCAGGG + Intronic
1151497592 17:74467916-74467938 CCTGCCTTGTTGCTGACTCAGGG + Intronic
1152354478 17:79800093-79800115 CCTGCAACGCTGCTCTCTCACGG - Intronic
1152755650 17:82085943-82085965 TCTGCCAGACTGAGGCCTCATGG - Intronic
1154163114 18:11994719-11994741 CCTGCATGGGGGCTGCCTCATGG - Intronic
1155541761 18:26876026-26876048 CCTGCCCAGCTGCTTCCGCAGGG + Intergenic
1156357171 18:36351739-36351761 CCTGCCAGGTATCTGCCTCAAGG - Intronic
1156443851 18:37219549-37219571 CCTGCCAGGCTGCTGTCTCGCGG + Intronic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
1156484780 18:37457748-37457770 CCTGCCAGGCCACAGCCTCCTGG - Intronic
1156537456 18:37878040-37878062 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1157845631 18:51001295-51001317 CTTTCCTGGCAGCTGCCTCAAGG - Intronic
1158379580 18:56914163-56914185 CCAGGCAGGCTCCTGCCTCAGGG + Intronic
1160116182 18:76081665-76081687 CCGGCCATGGTGCTGCCCCAGGG + Intergenic
1161028967 19:2049286-2049308 CCTGCTGGGCTGCTGCCTGCTGG + Intronic
1161645467 19:5450832-5450854 CCAGCCAGGGTGCAGCCTCAGGG + Intergenic
1161663999 19:5564057-5564079 CCTGCAACGCTGCTGCCTCGAGG + Intergenic
1161709398 19:5839337-5839359 CCTGCATTTCTGCTGCCTCAGGG - Exonic
1161779265 19:6280091-6280113 CCTGCCGGGCTGCGGCCGGAGGG + Intergenic
1161864904 19:6826669-6826691 CCTCCCGGGCTGCGGCCACACGG - Exonic
1162043567 19:7984716-7984738 CCTGCCTTCCTGCTGCCTCCAGG - Intronic
1162822754 19:13233164-13233186 CCAGCCATACTCCTGCCTCAGGG + Intronic
1163562850 19:18030777-18030799 CTTGCCATGTTGCTGCCTGAAGG - Intergenic
1163637563 19:18444493-18444515 CCTCCCTGGCTGCAGCCTCCGGG - Exonic
1163755510 19:19104283-19104305 CATGCATGCCTGCTGCCTCAAGG - Intronic
1164597631 19:29540485-29540507 TGTGCCTTGCTGCTGCCTCAGGG + Intronic
1165381999 19:35488299-35488321 CCTGCCTGGATGCTGCCCAATGG - Intronic
1166393930 19:42425084-42425106 CCTGCCAGGCTGCCTCCATAGGG - Intronic
1166952483 19:46438814-46438836 CCAGGCAGGCTCCAGCCTCAGGG - Intergenic
1166952678 19:46440228-46440250 CCAGGCAGGCTCCAGCCTCAGGG - Intergenic
1167150613 19:47707260-47707282 CCAGGCAGGCTCCTGCCACAGGG - Intergenic
1167362522 19:49037665-49037687 CCTCCGAGGCTGCGGCCTCGGGG - Intergenic
1167702069 19:51054701-51054723 CCAAACAGGCTCCTGCCTCAGGG + Intergenic
1168539690 19:57199827-57199849 CTTGCCTGGCAACTGCCTCAGGG + Intronic
925197719 2:1940197-1940219 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925197731 2:1940283-1940305 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925197765 2:1940541-1940563 CCTGGCAGGGTGCAGCCACAGGG - Intronic
925235002 2:2270285-2270307 CTGCCCAGGCTGCTGCCACAAGG - Intronic
925339612 2:3127066-3127088 CCTGCCCGGCTGCTGCCTCAGGG - Intergenic
926123379 2:10256661-10256683 CACGCCAGGCAGCTGCCTCTTGG - Intergenic
926825916 2:16904845-16904867 CTTGCCTGGCGACTGCCTCAGGG + Intergenic
927092650 2:19723782-19723804 TCTGCCAAGCTCCTGCCACACGG + Intergenic
927909967 2:26890484-26890506 CCTGCAGGGCTTCAGCCTCAGGG - Intronic
928900779 2:36315596-36315618 CCTGCCAGGCTGCTGCTCACGGG + Intergenic
928987188 2:37193131-37193153 CCTCCCATGCAGCTGCCTCTGGG - Intronic
930295472 2:49548038-49548060 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
930720492 2:54633159-54633181 CCTGACAGGCTTCTTTCTCATGG - Intronic
930734356 2:54760560-54760582 TCTGCAAGCCTGCTGCCTCTAGG - Intronic
930840193 2:55837266-55837288 CCTGCGAGGCTGCAGCCTGGCGG - Intergenic
930909828 2:56618345-56618367 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
931159124 2:59668752-59668774 CCTGCTAGGCTGCAGAGTCAAGG + Intergenic
931575806 2:63717272-63717294 CTTGCCATGTTGCTGCCTGAAGG - Intronic
932180666 2:69643546-69643568 GCTGCCAGGATGCCGCCTCGAGG - Intronic
932376902 2:71244438-71244460 CCTTCCAAGCTGCTGCTTTAAGG + Intergenic
932377557 2:71251146-71251168 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
934062002 2:88303482-88303504 CCTAGCACGCTTCTGCCTCAGGG + Intergenic
934501244 2:94861787-94861809 GCTCCCAGGCTGCTGCCTCTAGG - Intergenic
935902641 2:107809071-107809093 ATTGCCAAGTTGCTGCCTCATGG - Intergenic
936640963 2:114312540-114312562 CTTGCCTGGCAACTGCCTCAAGG - Intergenic
937025325 2:118692849-118692871 CCTGCCAGGCAACAGGCTCAGGG + Intergenic
937268995 2:120635400-120635422 CCAGCCACGCAGCAGCCTCAAGG - Intergenic
937800005 2:126072259-126072281 CCTGCCTGGCAACTGCCTCAGGG - Intergenic
938100324 2:128493629-128493651 CCTCCCAGGCTGCTGGGTCCGGG - Intergenic
938195580 2:129324597-129324619 CCTGCCTGGCTGCTGCATCTTGG + Intergenic
938249836 2:129806110-129806132 GCTGCCACACTGCTCCCTCAGGG - Intergenic
938572186 2:132570787-132570809 TCCTCTAGGCTGCTGCCTCAGGG - Intronic
939086190 2:137721215-137721237 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
939734007 2:145820840-145820862 CCAGACAAGCTCCTGCCTCAGGG + Intergenic
940472452 2:154116047-154116069 CTTGCCTGGCAACTGCCTCAGGG + Intronic
941667675 2:168258688-168258710 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
943239529 2:185365084-185365106 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
943318163 2:186414139-186414161 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
943710799 2:191092968-191092990 CCTGCCATGCTGCTGCCTTGCGG - Intronic
944676248 2:202035520-202035542 CCTGTCGGGCTGCTACTTCATGG + Exonic
945544562 2:211135682-211135704 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
945641850 2:212441363-212441385 CATGCCTGGCAACTGCCTCAGGG - Intronic
945716103 2:213359497-213359519 CCTGCGAGGCTGCAGCCTGGTGG - Intronic
946234711 2:218316852-218316874 CCTGACAGTCTCCTACCTCACGG - Intronic
946493784 2:220175322-220175344 CCTGCCAGGTTGCTAGCTCCTGG + Intergenic
947379085 2:229527551-229527573 CCTGCCAGGCTGGTGTCTCAAGG + Intronic
948807821 2:240460548-240460570 CCTGCCCGCCTGCTTCCTCCTGG + Intronic
948889323 2:240899225-240899247 CCTGCCAGGGCGCTGCCTGCAGG + Intergenic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1168762271 20:357279-357301 CCAGCCAGGATCCTGACTCAGGG + Intronic
1168829964 20:840489-840511 CCTGCAGGGCTGCAGTCTCATGG + Intronic
1169105110 20:2987867-2987889 CCCAGCATGCTGCTGCCTCAGGG + Intronic
1169795830 20:9461677-9461699 CCAGCCAGGTTGCTGCCTCACGG - Intronic
1170084576 20:12514575-12514597 CCTGACAGGCTGCTGATGCAAGG + Intergenic
1171022225 20:21596121-21596143 CCTGCCAGTCTCCTGCCTCAAGG + Intergenic
1171206779 20:23287794-23287816 CTTGTCAGGCTGCTGCCTTCAGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1171377511 20:24703374-24703396 CCTGCCTGGTGGCTGCCTCCAGG + Intergenic
1171892450 20:30728585-30728607 GCTCCCAGGCTGCTGCCTCCAGG - Intergenic
1172035474 20:32007861-32007883 CATGCCCGGCTGCTGCTCCAAGG + Intergenic
1172388827 20:34552505-34552527 CCTGTCAGGCTCATGCCCCAGGG - Intronic
1172389640 20:34558438-34558460 CGGGCCAGGCTGCAGCCCCACGG - Intronic
1173709467 20:45141734-45141756 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1174079303 20:47959711-47959733 TTTGTCAGTCTGCTGCCTCATGG + Intergenic
1174342810 20:49908377-49908399 GCTGCCAGGCCGCTGCCTGCTGG + Exonic
1174570667 20:51498960-51498982 CCAGGTAGGCTCCTGCCTCAGGG - Intronic
1175392628 20:58636698-58636720 CCTGCCACACTCCAGCCTCACGG + Intergenic
1175515244 20:59565942-59565964 CAGGCCAGGCTGGTGCCTGATGG + Intergenic
1175517067 20:59576737-59576759 CAGGCCAGGATCCTGCCTCAAGG + Intergenic
1175940922 20:62537253-62537275 CCTGCCAGGCGGCCTCCTCTGGG - Intergenic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176094224 20:63332608-63332630 CCGGCCAGGCTGCCTCCTCCTGG - Intronic
1176268354 20:64222394-64222416 CGTGCCCAGCTGCGGCCTCAGGG - Intronic
1176272708 20:64244759-64244781 CCTACCCTGCAGCTGCCTCAGGG + Intergenic
1176370600 21:6059695-6059717 TCTCCCAGGCTGCTGCAGCATGG + Intergenic
1176624752 21:9083440-9083462 GCTCCCAGGCTGCTGCCTCCAGG + Intergenic
1177002952 21:15636029-15636051 CTTGCCTGGCAGCTGCCTCCGGG + Intergenic
1177702767 21:24659995-24660017 TTTGCCAGCCTGCTGCCTCTGGG + Intergenic
1177912865 21:27053740-27053762 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1177962032 21:27679649-27679671 CCCACCTGGGTGCTGCCTCAGGG - Intergenic
1178934174 21:36846605-36846627 CTTCCCATTCTGCTGCCTCAAGG - Intronic
1179339484 21:40490749-40490771 CCTGCAAGGTTTCTGTCTCATGG + Intronic
1179575770 21:42307401-42307423 CCTGCCAGGTGGCTGCCAGACGG - Intergenic
1179752919 21:43478846-43478868 TCTCCCAGGCTGCTGCAGCATGG - Intergenic
1179934091 21:44591473-44591495 CCAGCCCAGCTGCTGCCGCACGG - Exonic
1179940794 21:44638065-44638087 CCAGCCCAGCTGCTGCCGCACGG + Exonic
1179974510 21:44856486-44856508 TCGGCCAGGCTGCTGGCTCCTGG + Intronic
1180059713 21:45378630-45378652 ACTGCCAGGCTGCTCCCTCCTGG + Intergenic
1180074696 21:45456550-45456572 CCTGCCAGTCTGCGGCCACCTGG + Intronic
1180791319 22:18577136-18577158 CCTGCCAAGCGGCTGCCTACAGG + Intergenic
1180944121 22:19680364-19680386 CTTGCGAGGCTGCTGCCTCCTGG - Intergenic
1180987763 22:19915436-19915458 CCTGCCAGGCTGATGGTTGATGG - Intronic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1181174205 22:21026760-21026782 CTTGGTAGGGTGCTGCCTCAGGG + Exonic
1181230418 22:21418175-21418197 CCTGCCAAGCGGCTGCCTACAGG - Intronic
1181248231 22:21516691-21516713 CCTGCCAAGCGGCTGCCTACAGG + Intergenic
1181466134 22:23111722-23111744 CCTCCCAGGCCCCTTCCTCAGGG + Intronic
1182352517 22:29706790-29706812 CCTGCCTGGCCCCTGCCTCTTGG - Intergenic
1182357749 22:29729937-29729959 CCAGATAGGCTGCTGTCTCAAGG - Exonic
1182543068 22:31055831-31055853 CCTGCCAGGCCTCTGCACCACGG - Intergenic
1182790805 22:32951282-32951304 GCAGCCATGCTGCTGGCTCAGGG - Intronic
1183198163 22:36367621-36367643 CCGGCCAGGCTGCCTGCTCAAGG - Intronic
1183365292 22:37403579-37403601 CCTGGGAGGCTGCGGCCTCGGGG + Intronic
1183451998 22:37901492-37901514 CCTGCCAGGATCCTGCCCCATGG + Intergenic
1183502093 22:38186693-38186715 CCAGGCGGGCTTCTGCCTCAGGG - Intronic
1184167032 22:42735768-42735790 CCCTCCAGGCCGCTGCCTGATGG + Intergenic
1184223960 22:43118500-43118522 CCAGCCTGGCTGCAGGCTCAGGG + Intronic
1184320815 22:43740941-43740963 GCTGCCAGGTTGCTGCTTCCCGG - Intronic
1184423768 22:44396988-44397010 CCTCCCAGGCTGCCTGCTCAAGG + Intergenic
1184582409 22:45426495-45426517 TCTGGCAGGGTCCTGCCTCAAGG - Intronic
1184679637 22:46063371-46063393 CCTGGCAGGCAGCTGCCCCATGG - Intronic
1185368564 22:50447995-50448017 CCTGCCAGACTCCAGACTCACGG + Intronic
1185374915 22:50478076-50478098 GCAGCCAGGCTGATGCCTGAGGG + Intergenic
949125986 3:445642-445664 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
949245543 3:1922426-1922448 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
949384847 3:3489666-3489688 CATGGCTGGCTGCTGCCTCCAGG + Intergenic
949445291 3:4128522-4128544 CTTGCCTGGCAGCTGCCTCAGGG - Intronic
950114582 3:10442353-10442375 CCTGCCCGGCAGCTGACTGAAGG - Intronic
950259890 3:11536100-11536122 CCAGCCAGGCTGTTTTCTCAGGG + Intronic
950273026 3:11634359-11634381 CCTGCCAGGCTCCTCCCCTAAGG + Intronic
950307594 3:11928403-11928425 CTTGCCAGGCTCCTTCCTCCTGG + Intergenic
950670168 3:14521186-14521208 CTGGCCATGCTCCTGCCTCAGGG + Intronic
950966825 3:17152387-17152409 CCTGCCTGACTCCTCCCTCAAGG - Intergenic
951012160 3:17693504-17693526 CCAGCCAGGCTGCCGCCTCGTGG - Intronic
952622431 3:35361746-35361768 CATGCCATTCTCCTGCCTCAGGG - Intergenic
952979468 3:38723250-38723272 ACGGCCAGGCTGCTGCCACCTGG + Intronic
953019638 3:39105256-39105278 CCTGCCATCCAGCTCCCTCAGGG + Intronic
953388212 3:42519106-42519128 TCTGCCAGGCTCCCACCTCAAGG - Intronic
953502780 3:43454169-43454191 ACAGCCAGGCTACTGCCTCAGGG - Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954511940 3:51132992-51133014 CCTGCCTGGCAACTGCCTCAGGG - Intronic
954521160 3:51227926-51227948 CCTTCCACTCTGCTTCCTCATGG - Intronic
954673527 3:52303389-52303411 CCTGCCAGTCTGTGGCCTCCTGG - Intergenic
955733755 3:62015250-62015272 CCAGGCAGGCTCCTGTCTCAGGG - Intronic
956304717 3:67811263-67811285 ACAGGCATGCTGCTGCCTCAGGG - Intergenic
956509317 3:69977871-69977893 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
957247860 3:77735822-77735844 CTTGCCTGGCAGCTGCTTCAGGG + Intergenic
958715412 3:97774401-97774423 CTTGCCTGGCAACTGCCTCAGGG + Intronic
958789168 3:98631069-98631091 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
959521727 3:107329028-107329050 CTTGCCATGTTGCTGCCTGAAGG + Intergenic
960352237 3:116607546-116607568 CCTGCCTGGATGCTGCCACAGGG + Intronic
960836056 3:121908103-121908125 CCTACTAGGCTGCTGCCTCGTGG + Intronic
960890526 3:122443224-122443246 CCTGCAAGGCTGCAGCCTGGCGG + Intronic
961339956 3:126211509-126211531 GCTGCCAGCCTGCAGCCTCCAGG - Intergenic
961658143 3:128454401-128454423 GCTGCCAAGCTCCTGCCACATGG + Intergenic
961930485 3:130528168-130528190 ATTGCAATGCTGCTGCCTCAAGG - Intergenic
962377978 3:134874636-134874658 CAGGCCAGCCTGCTGCCTCCAGG - Intronic
962776426 3:138665189-138665211 CCTTCCAGGATGTTGCCTTATGG - Exonic
963355987 3:144209329-144209351 CTTGCCCGGCAACTGCCTCAGGG + Intergenic
964406367 3:156352845-156352867 CCTGGCAGACCTCTGCCTCAGGG + Intronic
964977520 3:162638280-162638302 CTTGCCTGGCAACTGCCTCACGG + Intergenic
965034866 3:163424984-163425006 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
965191147 3:165531036-165531058 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
965768535 3:172156448-172156470 CCAGGCAGGTTGCTGCCTGAAGG + Intronic
966044648 3:175533410-175533432 CTTGCCTGGCAACTGCCTCAGGG + Intronic
967627985 3:191708439-191708461 CCTGCCTGGATGCTGCTGCAGGG + Intergenic
967831437 3:193923485-193923507 CCTGCCTGGAAACTGCCTCAGGG - Intergenic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969398518 4:6938536-6938558 GCTGCCAGGCTGGTGCCTGGTGG - Intronic
969414269 4:7048403-7048425 CCTCCCAAGCTGCTGAGTCAGGG + Intronic
969417038 4:7067778-7067800 GCTGCCAGGCTGCCAGCTCAGGG - Intronic
969652761 4:8477669-8477691 CCTGGCAGGAAGATGCCTCACGG - Intronic
970089517 4:12388846-12388868 CTTGCCTGGCACCTGCCTCAGGG + Intergenic
970597373 4:17612784-17612806 CCAGGCAGGCTGCTTCTTCAGGG + Intergenic
971685234 4:29757108-29757130 CTTGCCAGGCAACTGCCTCAAGG - Intergenic
972057006 4:34815568-34815590 CCTGCCAGGCCTCTGTCTGAGGG + Intergenic
972138545 4:35925307-35925329 CCTCACAGGCTGCTACCTGAAGG - Intergenic
972414922 4:38829759-38829781 CCTGTCTGGTTGCTGCCTGAGGG + Intronic
974438297 4:61884978-61885000 CCGGCCAGGCTGTTTCCTTATGG - Intronic
974726767 4:65808974-65808996 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
974871760 4:67652946-67652968 CCTGCGAGGCTGCAGCCTGGCGG + Intronic
975430412 4:74283735-74283757 CTTGCCAGCCTGCTGATTCATGG + Intronic
975844017 4:78506472-78506494 CCAGCCAGGCTACAGCCTCGCGG + Intronic
976760086 4:88539341-88539363 CCTGCGAGGCTGCAGCCTCGGGG + Intronic
977204327 4:94152809-94152831 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
977702062 4:100032374-100032396 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
977962787 4:103104441-103104463 CTTGCTTGGCAGCTGCCTCAGGG - Intergenic
978464541 4:108994376-108994398 CCTGCGAGGCTGCAGCTTGATGG + Intronic
978494020 4:109339999-109340021 CCAGCCAGGCTGCTGCCTCACGG - Intergenic
978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG + Intergenic
980957442 4:139443881-139443903 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
981834534 4:149039967-149039989 TTTGCCAGGCAACTGCCTCAGGG - Intergenic
982314326 4:154016251-154016273 GGTGCCTGGCTGCTGCCTCTTGG + Intergenic
982526879 4:156489923-156489945 CTTGCCAGGCACCTGCCTCAGGG - Intergenic
982835179 4:160114075-160114097 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
983581922 4:169317773-169317795 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
984849435 4:184141294-184141316 CCTCGCAGGCTGCTGCCTCCGGG + Intronic
985231938 4:187827846-187827868 CCTGCCAGGATGCTGGCTGGAGG - Intergenic
985285894 4:188336332-188336354 CCCGCCATTCTCCTGCCTCAGGG + Intergenic
985337157 4:188908591-188908613 CCTGTCAGGCTGAAGACTCAGGG - Intergenic
985340570 4:188948538-188948560 CCCGCCATTCTCCTGCCTCAGGG + Intergenic
985340578 4:188948564-188948586 CCCGCCATTCTCCTGCCTCAGGG + Intergenic
985827135 5:2200803-2200825 CCTGCCTGTCTGCTTCCTCCTGG + Intergenic
986086793 5:4460225-4460247 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
986330002 5:6711099-6711121 CCTGGCACACTCCTGCCTCAGGG - Intergenic
987152845 5:15059186-15059208 CTTGCCTGGCAGCTGCCTGAGGG - Intergenic
987504082 5:18747369-18747391 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
987621512 5:20342423-20342445 CTTGCCTGGCAGCTGCCTCAGGG - Intronic
988441669 5:31241014-31241036 TCAGCCAGGCTGCAGCCCCAAGG + Intronic
988517568 5:31917989-31918011 CCGGCCAGGCTTCTGCTTCTGGG + Intronic
988561800 5:32288389-32288411 CTTGCCTGGCAGCTGCCTCAGGG - Intronic
988699859 5:33662666-33662688 CCAGCCAGGCAGATGCCACAGGG - Intronic
988968059 5:36439792-36439814 GCTTCCAGCCTCCTGCCTCATGG - Intergenic
989045635 5:37270727-37270749 CTTGCCTGGCAGCTGCCTCAGGG + Intergenic
989097450 5:37794508-37794530 CTTGCCTGGCAACTGCCTCAAGG - Intergenic
989426052 5:41297441-41297463 CCTGCCAGGATCCTGCAGCATGG + Intergenic
989605681 5:43242354-43242376 CCTGCCCAGCTGCTGCTTCAGGG - Intronic
990002393 5:50909795-50909817 CCTAGCAGGCTGCTGCCCCGGGG - Intergenic
991085403 5:62644281-62644303 CATGCCAAGCTGGTGCCCCAAGG - Intergenic
992178913 5:74177790-74177812 CATGCCAGGCTCCTGCCACAGGG + Intergenic
994052550 5:95379303-95379325 CCTGGTAGGCTGATGTCTCAGGG + Intergenic
994291708 5:98034471-98034493 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
995269876 5:110207959-110207981 CTTGCCAGGCAGCTGCCTCAGGG + Intergenic
995352389 5:111194438-111194460 TAAGCCAGGCTGCTGCCTTAAGG - Intergenic
995638105 5:114219126-114219148 CCTGCCTGGATGCTGCTGCAGGG - Intergenic
996570151 5:124924902-124924924 CCAGCCATGCTCCTGCCTCAGGG - Intergenic
997453890 5:134004188-134004210 CCGGCCACGCTGCCGCCTCGGGG - Intronic
997641151 5:135449711-135449733 CCTGCTGGCCTTCTGCCTCAAGG - Exonic
998290669 5:140911083-140911105 CTTGCCTGGCAACTGCCTCAGGG + Intronic
999722045 5:154405524-154405546 CCTGCCTGGCTCCCTCCTCAGGG - Intronic
1000152501 5:158517434-158517456 CCTGGCAGGGACCTGCCTCAGGG - Intergenic
1000416647 5:160991454-160991476 CTTGCCTGGCAACTGCCTCATGG - Intergenic
1000730457 5:164828467-164828489 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1001082383 5:168676875-168676897 CCTGCCTGGCAGCTGGCTCCAGG + Intronic
1001679327 5:173544509-173544531 CCTGCCATGCCTCAGCCTCAGGG - Intergenic
1001770903 5:174295129-174295151 CCTGCCAGGCTGGAGGCTCAGGG + Intergenic
1002582264 5:180215999-180216021 CCAGCCAGGCTGTTGGCTCTGGG - Intergenic
1003875570 6:10433516-10433538 CCAGCCATGCTTCTGCCTCAGGG - Intergenic
1004740052 6:18450825-18450847 CCTGCAAAGTTGCTACCTCAGGG + Intronic
1006792833 6:36714881-36714903 CTAGCCTGGCTCCTGCCTCAGGG + Intronic
1007213744 6:40219675-40219697 CCTTCAAGGCAACTGCCTCAGGG - Intergenic
1007433152 6:41787884-41787906 CTTGCGAGGCTGGCGCCTCAGGG + Intronic
1007925667 6:45647562-45647584 CATTCTTGGCTGCTGCCTCATGG + Intronic
1008399959 6:51052989-51053011 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1009806155 6:68604322-68604344 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1010323250 6:74537972-74537994 CCTGCCTGGCAACTGCCTCAGGG - Intergenic
1010325638 6:74559089-74559111 CTTGCCTGGCAACTGCCTCATGG + Intergenic
1010552110 6:77236229-77236251 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1010581043 6:77596238-77596260 CATGCCTGGCAACTGCCTCAGGG + Intergenic
1010820670 6:80411687-80411709 CCTGCGAGGCTGCAGCCTGATGG - Intergenic
1010938477 6:81888197-81888219 CTTGCCTGGCAACTGCCTCATGG + Intergenic
1011039682 6:83015751-83015773 CTTGCCTGGCAACTGCCTCAGGG + Intronic
1011068710 6:83358838-83358860 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1012589984 6:100969112-100969134 CCAGCCAGGCTGCCGCCTAGCGG - Intergenic
1012820483 6:104080439-104080461 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1014761614 6:125363414-125363436 GCTCCCAGGCTCCCGCCTCACGG + Intergenic
1015502425 6:133948187-133948209 CCTGACAGGCTCCTGCAGCATGG - Intergenic
1016219882 6:141655117-141655139 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1017213123 6:151879147-151879169 CCTCTCAGGCTGCAGCCTCCCGG - Intronic
1017329719 6:153182211-153182233 CCTGCCAGGCTCATTCCCCAGGG - Intergenic
1017457572 6:154615813-154615835 CCTGGGAGGTTGCTGCCTCCAGG + Intergenic
1017564612 6:155670036-155670058 CCCACCATGCTGCTGTCTCATGG + Intergenic
1017977438 6:159370537-159370559 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1018107658 6:160504297-160504319 CTTGCCTGGCAACTGCCTCACGG + Intergenic
1018123305 6:160658024-160658046 CTTGCCTGGCAGCTGCCTCAGGG + Intronic
1018208637 6:161459256-161459278 CCTGCCAGTCTGCAACCTAAAGG + Intronic
1018655075 6:166026731-166026753 CCAGGCAGGCTCCTGCCTCCAGG + Intergenic
1019040484 6:169099944-169099966 CTTGCCTGGCAACTGCCTCAAGG - Intergenic
1019099784 6:169620153-169620175 CCTGCAGGGATGCTGTCTCAGGG + Intronic
1019335397 7:480350-480372 CCTCCCACTCTGCTGCCTCCAGG - Intergenic
1019455506 7:1124890-1124912 CCTGCCAGGCCTCAGCCTCCGGG + Intronic
1019803976 7:3109061-3109083 CCCGCCAGCCTCCTGCCTCCCGG - Intergenic
1020259326 7:6521815-6521837 CCTGCAAGACTCCTGCCTCTTGG - Intronic
1020567687 7:9818242-9818264 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1020709997 7:11595123-11595145 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1020961237 7:14805286-14805308 CATTGCAGGCTGCTGCCTTAGGG + Intronic
1021775689 7:24053128-24053150 CCAACCAGTCAGCTGCCTCAAGG + Intergenic
1022078566 7:26997848-26997870 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1022480627 7:30741003-30741025 ACACCCTGGCTGCTGCCTCAGGG - Intronic
1022871693 7:34486920-34486942 GCTGCCAGGCTGTTACCTCTGGG - Intergenic
1023010091 7:35918382-35918404 CATGCCAGGCTACTCCCTGAGGG + Intergenic
1024080734 7:45853197-45853219 CATGCCAGGCTACTCCCTGAGGG - Intergenic
1024506407 7:50165840-50165862 CCTCCCAGGAAGCAGCCTCATGG + Intergenic
1024958585 7:54951574-54951596 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1025123722 7:56328483-56328505 CATGCCAGGCTACTCCCTGAGGG + Intergenic
1025761834 7:64403004-64403026 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1026509541 7:71016660-71016682 CAAGCCATGCTGCTGCCTGAAGG + Intergenic
1026965313 7:74435547-74435569 CCTCCCAGGTTACTGCCTCCAGG - Intergenic
1027253471 7:76414452-76414474 CATGCCAGGCTGCTCCCAAAGGG - Intronic
1028043544 7:86088973-86088995 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1028345823 7:89780451-89780473 CCCGCCTGGATGCTGCCACAGGG + Intergenic
1029960921 7:104688674-104688696 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1030944770 7:115704422-115704444 CCAGCCACACTCCTGCCTCATGG + Intergenic
1031063368 7:117076716-117076738 CCTGCCTGGATGCTGCCACAAGG - Intronic
1031069521 7:117146304-117146326 CCAGACATACTGCTGCCTCAGGG - Intronic
1032338723 7:131050523-131050545 CCAGGCATGCTTCTGCCTCAAGG + Intergenic
1033408665 7:141095848-141095870 CACTCCAGGATGCTGCCTCACGG + Intronic
1033494570 7:141881118-141881140 ACTGCCTGGCTGCTGCCACAAGG - Intergenic
1034169615 7:149052876-149052898 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1034235036 7:149560034-149560056 GCTGCAAGGCTGCTGGCTGAGGG - Intergenic
1034466699 7:151233979-151234001 CCTGCCAGGTGGGTGCCCCAGGG - Exonic
1035250596 7:157594477-157594499 CCTGCCTGGATTCTGCCGCATGG + Intronic
1035464286 7:159064638-159064660 CCGGCCAGGCTGCTCTCTCGAGG + Intronic
1035818816 8:2569485-2569507 CGTGCCAGGCTGCTGCCGAGGGG + Intergenic
1035874786 8:3176710-3176732 CCTGCCACGCAGCTCCCTGATGG - Intronic
1037039695 8:14216108-14216130 CCTGCAAGGCTACTCTCTCAGGG - Intronic
1037129368 8:15389117-15389139 CCTGTCAGTCTGCAGCCTGAGGG + Intergenic
1037835591 8:22213140-22213162 CATGCCAGGCTGCTTCCTGGGGG - Intergenic
1038011824 8:23481998-23482020 CCGGCCTGCCTGCTGACTCATGG - Intergenic
1039183888 8:34895302-34895324 TCTGCCCGGCCGCTGCCTCTGGG + Intergenic
1039330295 8:36530374-36530396 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1041930297 8:63279497-63279519 CCTGGCTGGCTCCTGCCTGAAGG + Intergenic
1042445862 8:68884565-68884587 CCTGCCAGGACACTGCCACAGGG - Intergenic
1042864251 8:73343792-73343814 GCTGCTATGCTCCTGCCTCAGGG - Intergenic
1044184954 8:89239977-89239999 CCTCTCTGGCTGCTCCCTCAAGG + Intergenic
1046398805 8:113676544-113676566 CCTGCCTGGCTGCTGCTGCAGGG + Intergenic
1046417971 8:113940316-113940338 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG + Intergenic
1047317146 8:123745202-123745224 CCTGTCTGTCTTCTGCCTCATGG - Intergenic
1048084209 8:131159643-131159665 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1048503959 8:135004096-135004118 CCAGCCAGCCTGCAGCCTAATGG + Intergenic
1048580488 8:135726184-135726206 CCAGCCAGGCTGCTGCACAAGGG + Intergenic
1049157355 8:141075226-141075248 CCTGCCATGCAGCTGCCTGGAGG - Intergenic
1049412775 8:142480875-142480897 CCTGCCTGGCTGCATCCACAGGG - Intronic
1049486941 8:142870368-142870390 CTTGCAAGGCAGCTCCCTCAGGG + Intronic
1049784119 8:144442485-144442507 CCTGCCATGCTGTGGTCTCAGGG + Intronic
1049795624 8:144496146-144496168 CCTGCTAGGCTGCTCCTCCAGGG - Intronic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1050447376 9:5739616-5739638 CTTGCCTGGCGACTGCCTCAGGG + Intronic
1051881804 9:21848145-21848167 CTTGCCTGGCAACTGCCTCAGGG - Intronic
1051883478 9:21864778-21864800 CCTGCAGGGCAGCTGGCTCAGGG - Exonic
1052217341 9:25982960-25982982 CCAGTCAGGCTGCTGCCTTGTGG - Intergenic
1052970169 9:34372532-34372554 CCTGCTGGGCTGCTCGCTCACGG - Exonic
1053379415 9:37636439-37636461 CCTGCTCTGCTGCTGCCTCTAGG - Intronic
1054356373 9:64067150-64067172 GCTCCCAGGCTGCTGCCTCCAGG + Intergenic
1055205315 9:73722758-73722780 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1055733372 9:79302425-79302447 CCTGCCAGGCTACTGTCACCTGG - Intergenic
1056300861 9:85239407-85239429 CCTGCCAGGCTGCTGTGCTATGG - Intergenic
1057577403 9:96254369-96254391 CCAGGCAGCCTGCTGGCTCAAGG + Intronic
1058940163 9:109805950-109805972 CCTCCCAGGCTCCTGACTCCAGG + Intronic
1060059168 9:120443713-120443735 CCTGGTAGGCTGCTCCCACAGGG + Exonic
1060508744 9:124217002-124217024 TCTGCCAGGCTGCAGCCTTGGGG + Intergenic
1060656653 9:125376675-125376697 CCTGCCCTGCTGCTTCCTCCCGG - Intergenic
1060741345 9:126099569-126099591 CCTGCCTGGCCACTGCCTCCAGG - Intergenic
1061158218 9:128878014-128878036 CATGCCAGGCCGCAGCCTCTTGG + Intronic
1061189215 9:129071808-129071830 CCTCCCAGGCTGATGCCTGGAGG + Exonic
1061382830 9:130268592-130268614 ACTCACAGGCTGCTTCCTCAGGG - Intergenic
1061552387 9:131345112-131345134 GCAGCCTGGCTGCCGCCTCACGG + Intergenic
1062004000 9:134230301-134230323 CCTGCCATGCTTCTCCCTCTGGG + Intergenic
1062183274 9:135202579-135202601 CCTGCCTGGCTGGTGCCCCCAGG - Intergenic
1062385478 9:136309348-136309370 CCCGCCACGCCCCTGCCTCATGG + Intergenic
1062447550 9:136601989-136602011 TTTGCCAGGCTGGGGCCTCAGGG + Intergenic
1203747917 Un_GL000218v1:53868-53890 GCTCCCAGGCTGCTGCCTCCAGG + Intergenic
1203561814 Un_KI270744v1:64105-64127 GCTCCCAGGCTGCTGCCTCCAGG - Intergenic
1186843464 X:13508216-13508238 CTTCCCAGGCTGCTGACTTAGGG - Intergenic
1187340886 X:18420506-18420528 CCTGTCAGGCTTGTGGCTCATGG - Intergenic
1187485881 X:19702993-19703015 CCTGCCATGCTTCTGGCTCCTGG - Intronic
1188147090 X:26627651-26627673 CCTGCCAACCTCCTCCCTCAGGG + Intergenic
1190711856 X:53077334-53077356 CCGGCCAGGCTGCTGCCAACTGG + Exonic
1191742852 X:64453798-64453820 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1191745057 X:64477675-64477697 CCTGCAAGACTGCGGCCTCGTGG - Intergenic
1191769811 X:64742595-64742617 CTTGCCTGGCAACTGCCTCAAGG + Intergenic
1191945937 X:66535411-66535433 CTTGCCTGGCAGCTGCCTCAGGG - Intergenic
1192298041 X:69870487-69870509 CTTGCCTGGCAACTGCCTCAGGG + Intronic
1192678840 X:73230242-73230264 CCTACCAGGCTGCTGCCACACGG - Intergenic
1192935950 X:75858664-75858686 CTCCCCAGGCTGCTCCCTCATGG - Intergenic
1193876966 X:86872803-86872825 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1194073055 X:89351013-89351035 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1194513727 X:94824739-94824761 CTTGCCCGGCAACTGCCTCAGGG + Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1196372649 X:114996638-114996660 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1197001979 X:121450553-121450575 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1197044138 X:121975948-121975970 CTTGCCTGGCAACTGCCTCAGGG - Intergenic
1197409539 X:126098330-126098352 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1197959636 X:131989873-131989895 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1198212704 X:134530351-134530373 CTTGCCAGGCTGCCTCTTCAGGG + Intergenic
1200340618 X:155391584-155391606 CTTGCCTGGCAACTGCCTCAGGG + Intergenic
1200371391 X:155728533-155728555 CCTGCAAGGCTGCAGCCTGGAGG - Intergenic
1200405917 Y:2811360-2811382 GCTGCCAGGCTGCTGCTTGCAGG + Intergenic
1200727292 Y:6686753-6686775 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1200728444 Y:6702528-6702550 CCTGCCAGGTTGCAGGTTCATGG + Intergenic
1201161261 Y:11168862-11168884 GCTCCCAGGCTGCTGCCTCCAGG + Intergenic
1201364279 Y:13186435-13186457 CCCACAAGGCTGCAGCCTCATGG - Intergenic
1201938703 Y:19435303-19435325 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1202054837 Y:20818874-20818896 CCTGCGATGCTGCAGCCTTACGG + Intergenic